EMAIL THIS PAGE TO A FRIEND

LY96

lymphocyte antigen 96

53 Gene Product Result for
Synonyms: ESOP-1 MD-2 MD2 ly-96
UniProtKB ID: Q9Y6Y9, B3Y6A5
Gene ID:
Human(23643) Summary: This gene encodes a protein which associates with toll-like receptor 4 on the cell surface and confers responsiveness to lipopolysaccyaride (LPS), thus providing a link between the receptor and LPS signaling. Studies of the mouse ortholog suggest that this gene may be involved in endotoxin neutralization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2010]
Mouse(17087) lymphocyte antigen 96
Rat(448830) lymphocyte antigen 96
domestic guinea pig(100729146) lymphocyte antigen 96
naked mole-rat(101722147) lymphocyte antigen 96
Domestic Rabbit(100009589) lymphocyte antigen 96
sheep(101108235) lymphocyte antigen 96
chicken(420189) lymphocyte antigen 96
domestic cat(101100862) lymphocyte antigen 96
cow(613753) lymphocyte antigen 96
Horse(100034040) lymphocyte antigen 96
dog(610524) lymphocyte antigen 96
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015364 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015364 Rosetta Predictions human pricing
NM_001024279 Rosetta Predictions rat pricing
NM_016923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129276 predicted 206
2 SASI_Hs01_00129278 predicted 346
3 SASI_Hs01_00129279 predicted 254
4 SASI_Hs01_00129280 predicted 279
5 SASI_Hs01_00129282 predicted 309
6 SASI_Hs01_00129283 predicted 258
7 SASI_Hs01_00129284 predicted 311
8 SASI_Hs01_00129285 predicted 334
9 SASI_Hs02_00347700 predicted 208
10 SASI_Hs02_00347701 predicted 249
11 SASI_Hs01_00129277 predicted 306
12 SASI_Hs01_00129281 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096956 predicted 229
2 SASI_Rn01_00096957 predicted 263
3 SASI_Rn01_00096958 predicted 227
4 SASI_Rn01_00096959 predicted 201
5 SASI_Rn01_00096960 predicted 266
6 SASI_Rn01_00096961 predicted 245
7 SASI_Rn01_00096962 predicted 195
8 SASI_Rn01_00096963 predicted 218
9 SASI_Rn01_00096964 predicted 235
10 SASI_Rn01_00096965 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164111 predicted 301
2 SASI_Mm01_00164112 predicted 281
3 SASI_Mm01_00164113 predicted 223
4 SASI_Mm01_00164114 predicted 234
5 SASI_Mm01_00164115 predicted 218
6 SASI_Mm01_00164116 predicted 243
7 SASI_Mm01_00164117 predicted 314
8 SASI_Mm01_00164118 predicted 279
9 SASI_Mm01_00164119 predicted 219
10 SASI_Mm01_00164120 predicted 214
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015364
LY96 MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 96
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015364.3-261s21c1
Sequence:CCGGCCAAAGGATTATTGCACATTTCTCGAGAAATGTGCAATAATCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015364.3-444s21c1
Sequence:CCGGCATTCTCCTTCAAGGGAATAACTCGAGTTATTCCCTTGAAGGAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-237s1c1
Sequence:CCGGCCTGTATAGAATTGAAAGGATCTCGAGATCCTTTCAATTCTATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-162s1c1
Sequence:CCGGGCAACTCATCCGATGCAAGTACTCGAGTACTTGCATCGGATGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-419s1c1
Sequence:CCGGGAGACTGTGAATACAACAATACTCGAGTATTGTTGTATTCACAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-350s1c1
Sequence:CCGGCCAAAGCGCAAAGAAGTTATTCTCGAGAATAACTTCTTTGCGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-373s1c1
Sequence:CCGGCCGAGGATCTGATGACGATTACTCGAGTAATCGTCATCAGATCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015364
LY96 MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 96
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015364.3-261s21c1
Sequence:CCGGCCAAAGGATTATTGCACATTTCTCGAGAAATGTGCAATAATCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015364.3-444s21c1
Sequence:CCGGCATTCTCCTTCAAGGGAATAACTCGAGTTATTCCCTTGAAGGAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-237s1c1
Sequence:CCGGCCTGTATAGAATTGAAAGGATCTCGAGATCCTTTCAATTCTATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-162s1c1
Sequence:CCGGGCAACTCATCCGATGCAAGTACTCGAGTACTTGCATCGGATGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-419s1c1
Sequence:CCGGGAGACTGTGAATACAACAATACTCGAGTATTGTTGTATTCACAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-350s1c1
Sequence:CCGGCCAAAGCGCAAAGAAGTTATTCTCGAGAATAACTTCTTTGCGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-373s1c1
Sequence:CCGGCCGAGGATCTGATGACGATTACTCGAGTAATCGTCATCAGATCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015364
LY96 MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 96
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015364.3-261s21c1
Sequence:CCGGCCAAAGGATTATTGCACATTTCTCGAGAAATGTGCAATAATCCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015364.3-444s21c1
Sequence:CCGGCATTCTCCTTCAAGGGAATAACTCGAGTTATTCCCTTGAAGGAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-237s1c1
Sequence:CCGGCCTGTATAGAATTGAAAGGATCTCGAGATCCTTTCAATTCTATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-162s1c1
Sequence:CCGGGCAACTCATCCGATGCAAGTACTCGAGTACTTGCATCGGATGAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-419s1c1
Sequence:CCGGGAGACTGTGAATACAACAATACTCGAGTATTGTTGTATTCACAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-350s1c1
Sequence:CCGGCCAAAGCGCAAAGAAGTTATTCTCGAGAATAACTTCTTTGCGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015364.2-373s1c1
Sequence:CCGGCCGAGGATCTGATGACGATTACTCGAGTAATCGTCATCAGATCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016923
LY96 MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 96
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016923.2-292s21c1
Sequence:CCGGCAGTGTCAACTCCATAGAGTTCTCGAGAACTCTATGGAGTTGACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016923.2-415s21c1
Sequence:CCGGCGAGGGAATACTATTTCCTAACTCGAGTTAGGAAATAGTATTCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016923.2-109s21c1
Sequence:CCGGGAAGCAACAGTGGTTCTGCAACTCGAGTTGCAGAACCACTGTTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016923.2-135s21c1
Sequence:CCGGCCGATGCAATTATTTCCTACACTCGAGTGTAGGAAATAATTGCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-415s1c1
Sequence:CCGGCGAGGGAATACTATTTCCTAACTCGAGTTAGGAAATAGTATTCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-109s1c1
Sequence:CCGGGAAGCAACAGTGGTTCTGCAACTCGAGTTGCAGAACCACTGTTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-178s1c1
Sequence:CCGGCCCTATTTCAATTAGTTCTGACTCGAGTCAGAACTAATTGAAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-292s1c1
Sequence:CCGGCAGTGTCAACTCCATAGAGTTCTCGAGAACTCTATGGAGTTGACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-135s1c1
Sequence:CCGGCCGATGCAATTATTTCCTACACTCGAGTGTAGGAAATAATTGCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016923
LY96 MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 96
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016923.2-292s21c1
Sequence:CCGGCAGTGTCAACTCCATAGAGTTCTCGAGAACTCTATGGAGTTGACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016923.2-415s21c1
Sequence:CCGGCGAGGGAATACTATTTCCTAACTCGAGTTAGGAAATAGTATTCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016923.2-109s21c1
Sequence:CCGGGAAGCAACAGTGGTTCTGCAACTCGAGTTGCAGAACCACTGTTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016923.2-135s21c1
Sequence:CCGGCCGATGCAATTATTTCCTACACTCGAGTGTAGGAAATAATTGCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-415s1c1
Sequence:CCGGCGAGGGAATACTATTTCCTAACTCGAGTTAGGAAATAGTATTCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-109s1c1
Sequence:CCGGGAAGCAACAGTGGTTCTGCAACTCGAGTTGCAGAACCACTGTTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-178s1c1
Sequence:CCGGCCCTATTTCAATTAGTTCTGACTCGAGTCAGAACTAATTGAAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-292s1c1
Sequence:CCGGCAGTGTCAACTCCATAGAGTTCTCGAGAACTCTATGGAGTTGACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-135s1c1
Sequence:CCGGCCGATGCAATTATTTCCTACACTCGAGTGTAGGAAATAATTGCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016923
LY96 MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 96
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016923.2-292s21c1
Sequence:CCGGCAGTGTCAACTCCATAGAGTTCTCGAGAACTCTATGGAGTTGACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016923.2-415s21c1
Sequence:CCGGCGAGGGAATACTATTTCCTAACTCGAGTTAGGAAATAGTATTCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016923.2-109s21c1
Sequence:CCGGGAAGCAACAGTGGTTCTGCAACTCGAGTTGCAGAACCACTGTTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016923.2-135s21c1
Sequence:CCGGCCGATGCAATTATTTCCTACACTCGAGTGTAGGAAATAATTGCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-415s1c1
Sequence:CCGGCGAGGGAATACTATTTCCTAACTCGAGTTAGGAAATAGTATTCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-109s1c1
Sequence:CCGGGAAGCAACAGTGGTTCTGCAACTCGAGTTGCAGAACCACTGTTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-178s1c1
Sequence:CCGGCCCTATTTCAATTAGTTCTGACTCGAGTCAGAACTAATTGAAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-292s1c1
Sequence:CCGGCAGTGTCAACTCCATAGAGTTCTCGAGAACTCTATGGAGTTGACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016923.1-135s1c1
Sequence:CCGGCCGATGCAATTATTTCCTACACTCGAGTGTAGGAAATAATTGCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)