EMAIL THIS PAGE TO A FRIEND

LY9

lymphocyte antigen 9

81 Gene Product Result for
Synonyms: CD229 SLAMF3 hly9 mLY9
Gene ID:
Human(4063) Summary: LY9 belongs to the SLAM family of immunomodulatory receptors (see SLAMF1; MIM 603492) and interacts with the adaptor molecule SAP (SH2D1A; MIM 300490) (Graham et al., 2006 [PubMed 16365421]
Mouse(17085) lymphocyte antigen 9
Rat(289227) lymphocyte antigen 9
dog(488643) lymphocyte antigen 9
domestic cat(101089325) lymphocyte antigen 9
cow(528926) lymphocyte antigen 9
Horse(100058830) lymphocyte antigen 9
sheep(101121646) lymphocyte antigen 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002348 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098391 MISSION® esiRNA esiRNA human LY9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033667 Rosetta Predictions human pricing
NM_002348 Rosetta Predictions human pricing
XM_001054622 Rosetta Predictions rat pricing
XM_222892 Rosetta Predictions rat pricing
NM_008534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158993 predicted 279
2 SASI_Hs01_00158994 predicted 260
3 SASI_Hs01_00158995 predicted 258
4 SASI_Hs01_00158996 predicted 245
5 SASI_Hs01_00158997 predicted 254
6 SASI_Hs01_00158998 predicted 248
7 SASI_Hs01_00158999 predicted 241
8 SASI_Hs01_00159000 predicted 282
9 SASI_Hs01_00159001 predicted 268
10 SASI_Hs01_00159002 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214750 predicted 283
2 SASI_Hs01_00214751 predicted 264
3 SASI_Hs01_00214752 predicted 262
4 SASI_Hs01_00214753 predicted 251
5 SASI_Hs01_00214754 predicted 258
6 SASI_Hs01_00214755 predicted 250
7 SASI_Hs01_00214756 predicted 242
8 SASI_Hs01_00214757 predicted 277
9 SASI_Hs01_00214758 predicted 263
10 SASI_Hs01_00214759 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276557 predicted 1399
2 SASI_Rn02_00276558 predicted 1654
3 SASI_Rn02_00276559 predicted 377
4 SASI_Rn02_00276560 predicted 1644
5 SASI_Rn02_00276561 predicted 1752
6 SASI_Rn02_00276562 predicted 1561
7 SASI_Rn02_00276563 predicted 280
8 SASI_Rn02_00276564 predicted 310
9 SASI_Rn02_00276565 predicted 237
10 SASI_Rn02_00276566 predicted 1565
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222892 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380977 predicted 1553
2 SASI_Rn02_00380978 predicted 1653
3 SASI_Rn02_00380979 predicted 1649
4 SASI_Rn02_00380980 predicted 1680
5 SASI_Rn02_00380981 predicted 1645
6 SASI_Rn02_00380982 predicted 1560
7 SASI_Rn02_00380983 predicted 1465
8 SASI_Rn02_00380984 predicted 1565
9 SASI_Rn02_00380985 predicted 1744
10 SASI_Rn02_00380986 predicted 1665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121391 predicted 576
2 SASI_Mm01_00121392 predicted 340
3 SASI_Mm02_00314126 predicted 214
4 SASI_Mm01_00121394 predicted 861
5 SASI_Mm01_00121396 predicted 352
6 SASI_Mm02_00314127 predicted 458
7 SASI_Mm01_00121397 predicted 688
8 SASI_Mm01_00121398 predicted 1078
9 SASI_Mm01_00121399 predicted 1478
10 SASI_Mm01_00121400 predicted 558
11 SASI_Mm01_00121393 predicted 798
12 SASI_Mm01_00121395 predicted 2003
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002348
VALIDATED
LY9 MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 9
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002348.1-421s1c1
Sequence:CCGGGCCCAGATAAACCAAAGGAATCTCGAGATTCCTTTGGTTTATCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002348.1-1695s1c1
Sequence:CCGGCAGTGGAAGATATGAGGTGTTCTCGAGAACACCTCATATCTTCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002348.1-102s1c1
Sequence:CCGGGCTGCAAATATTCTCTTCTGTCTCGAGACAGAAGAGAATATTTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_002348.1-859s1c1
Sequence:CCGGGAGAAGGTTGTCTGGTTGTTTCTCGAGAAACAACCAGACAACCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002348.1-1827s1c1
Sequence:CCGGCACCGTGTATGCACAAGTGTTCTCGAGAACACTTGTGCATACACGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002348.1-1443s1c1
Sequence:CCGGCTGGTGCATTTGGAAGCGAAACTCGAGTTTCGCTTCCAAATGCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002348.1-262s1c1
Sequence:CCGGGTCATCTGGATTGGTCCCAAACTCGAGTTTGGGACCAATCCAGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_002348.1-1894s1c1
Sequence:CCGGGCCACAATCTACTGCTCCATACTCGAGTATGGAGCAGTAGATTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002348.1-380s1c1
Sequence:CCGGGCATCAGCAATCTGACTCTGACTCGAGTCAGAGTCAGATTGCTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002348.2-421s21c1
Sequence:CCGGATGATGCAGGATCCTACAAAGCTCGAGCTTTGTAGGATCCTGCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002348.2-2272s21c1
Sequence:CCGGTAGCGTTTCCTCCTCGAAATTCTCGAGAATTTCGAGGAGGAAACGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002348.2-898s21c1
Sequence:CCGGTGTTTAACACATCCATCATTACTCGAGTAATGATGGATGTGTTAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002348.2-940s21c1
Sequence:CCGGCAACGGCAGATCCACTCATTACTCGAGTAATGAGTGGATCTGCCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002348.2-1858s21c1
Sequence:GTACCGGATGCACAAGTGTTCAACTTACCTCGAGGTAAGTTGAACACTTGTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002348
VALIDATED
LY9 MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 9
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002348.1-421s1c1
Sequence:CCGGGCCCAGATAAACCAAAGGAATCTCGAGATTCCTTTGGTTTATCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002348.1-1695s1c1
Sequence:CCGGCAGTGGAAGATATGAGGTGTTCTCGAGAACACCTCATATCTTCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002348.1-102s1c1
Sequence:CCGGGCTGCAAATATTCTCTTCTGTCTCGAGACAGAAGAGAATATTTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_002348.1-859s1c1
Sequence:CCGGGAGAAGGTTGTCTGGTTGTTTCTCGAGAAACAACCAGACAACCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002348.1-1827s1c1
Sequence:CCGGCACCGTGTATGCACAAGTGTTCTCGAGAACACTTGTGCATACACGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002348.1-1443s1c1
Sequence:CCGGCTGGTGCATTTGGAAGCGAAACTCGAGTTTCGCTTCCAAATGCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002348.1-262s1c1
Sequence:CCGGGTCATCTGGATTGGTCCCAAACTCGAGTTTGGGACCAATCCAGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_002348.1-1894s1c1
Sequence:CCGGGCCACAATCTACTGCTCCATACTCGAGTATGGAGCAGTAGATTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002348.1-380s1c1
Sequence:CCGGGCATCAGCAATCTGACTCTGACTCGAGTCAGAGTCAGATTGCTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002348.2-421s21c1
Sequence:CCGGATGATGCAGGATCCTACAAAGCTCGAGCTTTGTAGGATCCTGCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002348.2-2272s21c1
Sequence:CCGGTAGCGTTTCCTCCTCGAAATTCTCGAGAATTTCGAGGAGGAAACGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002348.2-898s21c1
Sequence:CCGGTGTTTAACACATCCATCATTACTCGAGTAATGATGGATGTGTTAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002348.2-940s21c1
Sequence:CCGGCAACGGCAGATCCACTCATTACTCGAGTAATGAGTGGATCTGCCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002348.2-1858s21c1
Sequence:GTACCGGATGCACAAGTGTTCAACTTACCTCGAGGTAAGTTGAACACTTGTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002348
VALIDATED
LY9 MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 9
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002348.1-421s1c1
Sequence:CCGGGCCCAGATAAACCAAAGGAATCTCGAGATTCCTTTGGTTTATCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002348.1-1695s1c1
Sequence:CCGGCAGTGGAAGATATGAGGTGTTCTCGAGAACACCTCATATCTTCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002348.1-102s1c1
Sequence:CCGGGCTGCAAATATTCTCTTCTGTCTCGAGACAGAAGAGAATATTTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_002348.1-859s1c1
Sequence:CCGGGAGAAGGTTGTCTGGTTGTTTCTCGAGAAACAACCAGACAACCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002348.1-1827s1c1
Sequence:CCGGCACCGTGTATGCACAAGTGTTCTCGAGAACACTTGTGCATACACGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002348.1-1443s1c1
Sequence:CCGGCTGGTGCATTTGGAAGCGAAACTCGAGTTTCGCTTCCAAATGCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002348.1-262s1c1
Sequence:CCGGGTCATCTGGATTGGTCCCAAACTCGAGTTTGGGACCAATCCAGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_002348.1-1894s1c1
Sequence:CCGGGCCACAATCTACTGCTCCATACTCGAGTATGGAGCAGTAGATTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002348.1-380s1c1
Sequence:CCGGGCATCAGCAATCTGACTCTGACTCGAGTCAGAGTCAGATTGCTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002348.2-421s21c1
Sequence:CCGGATGATGCAGGATCCTACAAAGCTCGAGCTTTGTAGGATCCTGCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002348.2-2272s21c1
Sequence:CCGGTAGCGTTTCCTCCTCGAAATTCTCGAGAATTTCGAGGAGGAAACGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002348.2-898s21c1
Sequence:CCGGTGTTTAACACATCCATCATTACTCGAGTAATGATGGATGTGTTAAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002348.2-940s21c1
Sequence:CCGGCAACGGCAGATCCACTCATTACTCGAGTAATGAGTGGATCTGCCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002348.2-1858s21c1
Sequence:GTACCGGATGCACAAGTGTTCAACTTACCTCGAGGTAAGTTGAACACTTGTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008534
LY9 MISSION shRNA Bacterial Glycerol Stock
lymphocyte antigen 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008534.1-2049s1c1
Sequence:CCGGCCTCTTCTTGTCATCCTCCTTCTCGAGAAGGAGGATGACAAGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008534.1-473s1c1
Sequence:CCGGCACCCTAATCTGCACTGTAAACTCGAGTTTACAGTGCAGATTAGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008534.1-202s1c1
Sequence:CCGGCAAAGGCTCTTGCTTTAGTATCTCGAGATACTAAAGCAAGAGCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008534.1-358s1c1
Sequence:CCGGAGAATGTTATCCTCACCACAACTCGAGTTGTGGTGAGGATAACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008534.1-1293s1c1
Sequence:CCGGCCTGAGAGAAACAAGAGGTTTCTCGAGAAACCTCTTGTTTCTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008534
LY9 MISSION shRNA shRNA Plasmid DNA
lymphocyte antigen 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008534.1-2049s1c1
Sequence:CCGGCCTCTTCTTGTCATCCTCCTTCTCGAGAAGGAGGATGACAAGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008534.1-473s1c1
Sequence:CCGGCACCCTAATCTGCACTGTAAACTCGAGTTTACAGTGCAGATTAGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008534.1-202s1c1
Sequence:CCGGCAAAGGCTCTTGCTTTAGTATCTCGAGATACTAAAGCAAGAGCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008534.1-358s1c1
Sequence:CCGGAGAATGTTATCCTCACCACAACTCGAGTTGTGGTGAGGATAACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008534.1-1293s1c1
Sequence:CCGGCCTGAGAGAAACAAGAGGTTTCTCGAGAAACCTCTTGTTTCTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008534
LY9 MISSION shRNA Lentiviral Transduction Particles
lymphocyte antigen 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008534.1-2049s1c1
Sequence:CCGGCCTCTTCTTGTCATCCTCCTTCTCGAGAAGGAGGATGACAAGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008534.1-473s1c1
Sequence:CCGGCACCCTAATCTGCACTGTAAACTCGAGTTTACAGTGCAGATTAGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008534.1-202s1c1
Sequence:CCGGCAAAGGCTCTTGCTTTAGTATCTCGAGATACTAAAGCAAGAGCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008534.1-358s1c1
Sequence:CCGGAGAATGTTATCCTCACCACAACTCGAGTTGTGGTGAGGATAACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008534.1-1293s1c1
Sequence:CCGGCCTGAGAGAAACAAGAGGTTTCTCGAGAAACCTCTTGTTTCTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)