EMAIL THIS PAGE TO A FRIEND

LYAR

Ly1 antibody reactive

72 Gene Product Result for
Synonyms: ZC2HC2 ZLYAR
UniProtKB ID: Q9NX58, D3DVS4, Q6FI78, Q9NYS1
Gene ID:
Mouse(17089) Ly1 antibody reactive clone
Rat(289707) Ly1 antibody reactive
sheep(101103898) Ly1 antibody reactive homolog (mouse)
naked mole-rat(101704670) Ly1 antibody reactive
domestic guinea pig(100727750) Ly1 antibody reactive
Zebrafish(393652) Ly1 antibody reactive homolog (mouse)
cow(537667) Ly1 antibody reactive homolog (mouse)
domestic cat(101088840) Ly1 antibody reactive homolog (mouse)
dog(479095) Ly1 antibody reactive homolog (mouse)
chicken(422846) Ly1 antibody reactive homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025281 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025281 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025281 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017816 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017816 Rosetta Predictions human pricing
NM_001011911 Rosetta Predictions rat pricing
XM_573629 Rosetta Predictions rat pricing
NM_025281 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246881 predicted 1012
2 SASI_Hs01_00246882 predicted 362
3 SASI_Hs01_00246883 predicted 279
4 SASI_Hs01_00246884 predicted 1078
5 SASI_Hs01_00246886 predicted 199
6 SASI_Hs01_00246887 predicted 1119
7 SASI_Hs02_00350681 predicted 431
8 SASI_Hs01_00246889 predicted 1069
9 SASI_Hs01_00246890 predicted 1209
10 SASI_Hs02_00350682 predicted 1237
11 SASI_Hs01_00246885 predicted 1287
12 SASI_Hs01_00246888 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093789 predicted 345
2 SASI_Rn01_00093790 predicted 209
3 SASI_Rn01_00093791 predicted 303
4 SASI_Rn01_00093793 predicted 481
5 SASI_Rn02_00199903 predicted 299
6 SASI_Rn01_00093795 predicted 285
7 SASI_Rn02_00199904 predicted 232
8 SASI_Rn02_00199905 predicted 210
9 SASI_Rn01_00093798 predicted 434
10 SASI_Rn02_00199906 predicted 355
11 SASI_Rn01_00093792 predicted 357
12 SASI_Rn01_00093794 predicted 228
13 SASI_Rn01_00093796 predicted 392
14 SASI_Rn01_00093797 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162920 predicted 371
2 SASI_Rn01_00162921 predicted 237
3 SASI_Rn01_00162922 predicted 253
4 SASI_Rn01_00162923 predicted 316
5 SASI_Rn01_00162924 predicted 321
6 SASI_Rn01_00162925 predicted 367
7 SASI_Rn01_00162926 predicted 239
8 SASI_Rn01_00162927 predicted 254
9 SASI_Rn01_00162928 predicted 321
10 SASI_Rn01_00162929 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025281 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139397 predicted 395
2 SASI_Mm01_00139398 predicted 338
3 SASI_Mm01_00139399 predicted 293
4 SASI_Mm01_00139400 predicted 397
5 SASI_Mm01_00139401 predicted 378
6 SASI_Mm01_00139402 predicted 261
7 SASI_Mm01_00139404 predicted 274
8 SASI_Mm01_00139405 predicted 281
9 SASI_Mm02_00327893 predicted 211
10 SASI_Mm01_00139406 predicted 343
11 SASI_Mm01_00139403 predicted 1237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025281
VALIDATED
LYAR MISSION shRNA Bacterial Glycerol Stock
Ly1 antibody reactive
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025281.1-1315s1c1
Sequence:CCGGCTTCACACTCTGTCATCCTATCTCGAGATAGGATGACAGAGTGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025281.1-619s1c1
Sequence:CCGGTGCCGATCACTAAAGTTCCATCTCGAGATGGAACTTTAGTGATCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025281.1-621s1c1
Sequence:CCGGCCGATCACTAAAGTTCCATCTCTCGAGAGATGGAACTTTAGTGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025281.1-1139s1c1
Sequence:CCGGCGAGATATCAGTCAAGAAGTTCTCGAGAACTTCTTGACTGATATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025281.1-1140s1c1
Sequence:CCGGGAGATATCAGTCAAGAAGTTACTCGAGTAACTTCTTGACTGATATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025281.3-1381s21c1
Sequence:CCGGCTTCACACTCTGTCATCCTATCTCGAGATAGGATGACAGAGTGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025281.3-685s21c1
Sequence:CCGGTGCCGATCACTAAAGTTCCATCTCGAGATGGAACTTTAGTGATCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025281.3-1136s21c1
Sequence:CCGGGGCTCCATCGAAAGGTAAATTCTCGAGAATTTACCTTTCGATGGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025281.3-1205s21c1
Sequence:CCGGCGAGATATCAGTCAAGAAGTTCTCGAGAACTTCTTGACTGATATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025281
VALIDATED
LYAR MISSION shRNA shRNA Plasmid DNA
Ly1 antibody reactive
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025281.1-1315s1c1
Sequence:CCGGCTTCACACTCTGTCATCCTATCTCGAGATAGGATGACAGAGTGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025281.1-619s1c1
Sequence:CCGGTGCCGATCACTAAAGTTCCATCTCGAGATGGAACTTTAGTGATCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025281.1-621s1c1
Sequence:CCGGCCGATCACTAAAGTTCCATCTCTCGAGAGATGGAACTTTAGTGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025281.1-1139s1c1
Sequence:CCGGCGAGATATCAGTCAAGAAGTTCTCGAGAACTTCTTGACTGATATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025281.1-1140s1c1
Sequence:CCGGGAGATATCAGTCAAGAAGTTACTCGAGTAACTTCTTGACTGATATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025281.3-1381s21c1
Sequence:CCGGCTTCACACTCTGTCATCCTATCTCGAGATAGGATGACAGAGTGTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025281.3-685s21c1
Sequence:CCGGTGCCGATCACTAAAGTTCCATCTCGAGATGGAACTTTAGTGATCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025281.3-1136s21c1
Sequence:CCGGGGCTCCATCGAAAGGTAAATTCTCGAGAATTTACCTTTCGATGGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025281.3-1205s21c1
Sequence:CCGGCGAGATATCAGTCAAGAAGTTCTCGAGAACTTCTTGACTGATATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025281
VALIDATED
LYAR MISSION shRNA Lentiviral Transduction Particles
Ly1 antibody reactive
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025281.1-1315s1c1
Sequence:CCGGCTTCACACTCTGTCATCCTATCTCGAGATAGGATGACAGAGTGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025281.1-619s1c1
Sequence:CCGGTGCCGATCACTAAAGTTCCATCTCGAGATGGAACTTTAGTGATCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025281.1-621s1c1
Sequence:CCGGCCGATCACTAAAGTTCCATCTCTCGAGAGATGGAACTTTAGTGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025281.1-1139s1c1
Sequence:CCGGCGAGATATCAGTCAAGAAGTTCTCGAGAACTTCTTGACTGATATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025281.1-1140s1c1
Sequence:CCGGGAGATATCAGTCAAGAAGTTACTCGAGTAACTTCTTGACTGATATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025281.3-1381s21c1
Sequence:CCGGCTTCACACTCTGTCATCCTATCTCGAGATAGGATGACAGAGTGTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025281.3-685s21c1
Sequence:CCGGTGCCGATCACTAAAGTTCCATCTCGAGATGGAACTTTAGTGATCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025281.3-1136s21c1
Sequence:CCGGGGCTCCATCGAAAGGTAAATTCTCGAGAATTTACCTTTCGATGGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025281.3-1205s21c1
Sequence:CCGGCGAGATATCAGTCAAGAAGTTCTCGAGAACTTCTTGACTGATATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017816
VALIDATED
LYAR MISSION shRNA Bacterial Glycerol Stock
Ly1 antibody reactive
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017816.2-1060s21c1
Sequence:CCGAGAGGCACTCGGAAGTTGAAACCTCGAGGTTTCAACTTCCGAGTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-1250s1c1
Sequence:CCGGCCTGGTCATCTTTAACAAGAACTCGAGTTCTTGTTAAAGATGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-610s1c1
Sequence:CCGGCCAACAGCGAACCAGTCAATACTCGAGTATTGACTGGTTCGCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-840s1c1
Sequence:CCGGCAGAAGCCTAAGAAGCGCAAACTCGAGTTTGCGCTTCTTAGGCTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-1368s1c1
Sequence:CCGGTCTTCCTTTCACTGCTGTTTACTCGAGTAAACAGCAGTGAAAGGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-1277s1c1
Sequence:CCGGCAAGAACCCTACCTTTAAGTTCTCGAGAACTTAAAGGTAGGGTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017816.2-1167s21c1
Sequence:CCGGTCAACTGGAAGGGAACTATTACTCGAGTAATAGTTCCCTTCCAGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017816
VALIDATED
LYAR MISSION shRNA shRNA Plasmid DNA
Ly1 antibody reactive
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017816.2-1060s21c1
Sequence:CCGAGAGGCACTCGGAAGTTGAAACCTCGAGGTTTCAACTTCCGAGTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-1250s1c1
Sequence:CCGGCCTGGTCATCTTTAACAAGAACTCGAGTTCTTGTTAAAGATGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-610s1c1
Sequence:CCGGCCAACAGCGAACCAGTCAATACTCGAGTATTGACTGGTTCGCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-840s1c1
Sequence:CCGGCAGAAGCCTAAGAAGCGCAAACTCGAGTTTGCGCTTCTTAGGCTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-1368s1c1
Sequence:CCGGTCTTCCTTTCACTGCTGTTTACTCGAGTAAACAGCAGTGAAAGGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-1277s1c1
Sequence:CCGGCAAGAACCCTACCTTTAAGTTCTCGAGAACTTAAAGGTAGGGTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017816.2-1167s21c1
Sequence:CCGGTCAACTGGAAGGGAACTATTACTCGAGTAATAGTTCCCTTCCAGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017816
VALIDATED
LYAR MISSION shRNA Lentiviral Transduction Particles
Ly1 antibody reactive
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017816.2-1060s21c1
Sequence:CCGAGAGGCACTCGGAAGTTGAAACCTCGAGGTTTCAACTTCCGAGTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-1250s1c1
Sequence:CCGGCCTGGTCATCTTTAACAAGAACTCGAGTTCTTGTTAAAGATGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-610s1c1
Sequence:CCGGCCAACAGCGAACCAGTCAATACTCGAGTATTGACTGGTTCGCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-840s1c1
Sequence:CCGGCAGAAGCCTAAGAAGCGCAAACTCGAGTTTGCGCTTCTTAGGCTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072303    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-1368s1c1
Sequence:CCGGTCTTCCTTTCACTGCTGTTTACTCGAGTAAACAGCAGTGAAAGGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_017816.1-1277s1c1
Sequence:CCGGCAAGAACCCTACCTTTAAGTTCTCGAGAACTTAAAGGTAGGGTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017816.2-1167s21c1
Sequence:CCGGTCAACTGGAAGGGAACTATTACTCGAGTAATAGTTCCCTTCCAGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)