EMAIL THIS PAGE TO A FRIEND

LYG1

lysozyme G-like 1

74 Gene Product Result for
Synonyms: SALW1939
UniProtKB ID: Q8N1E2, Q53RV9
Gene ID:
Mouse(69541) lysozyme G-like 1
Rat(503254) lysozyme G-like 1
dog(611605) lysozyme G-like 1
cow(787329) lysozyme G-like 1
domestic cat(101086644) lysozyme G-like 1
domestic guinea pig(100721992) lysozyme G-like 1
naked mole-rat(101698584) lysozyme G-like 1
sheep(101106578) lysozyme G-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174898 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027111 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027111 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027111 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174898 Rosetta Predictions human pricing
NM_001098838 Rosetta Predictions rat pricing
XM_001057968 Rosetta Predictions rat pricing
NM_027111 Rosetta Predictions mouse pricing
XM_355298 Rosetta Predictions mouse pricing
XM_898945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245312 predicted 630
2 SASI_Hs01_00245313 predicted 427
3 SASI_Hs01_00245314 predicted 637
4 SASI_Hs01_00245315 predicted 757
5 SASI_Hs01_00245316 predicted 525
6 SASI_Hs01_00245317 predicted 282
7 SASI_Hs01_00245318 predicted 414
8 SASI_Hs01_00245319 predicted 760
9 SASI_Hs01_00245320 predicted 429
10 SASI_Hs01_00245321 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209201 predicted 237
2 SASI_Rn02_00209202 predicted 461
3 SASI_Rn02_00209203 predicted 317
4 SASI_Rn02_00209204 predicted 260
5 SASI_Rn02_00209205 predicted 546
6 SASI_Rn02_00209206 predicted 558
7 SASI_Rn02_00209207 predicted 331
8 SASI_Rn02_00209208 predicted 302
9 SASI_Rn02_00209209 predicted 272
10 SASI_Rn02_00209210 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288116 predicted 245
2 SASI_Rn02_00288117 predicted 459
3 SASI_Rn02_00288118 predicted 315
4 SASI_Rn02_00288119 predicted 260
5 SASI_Rn02_00288120 predicted 549
6 SASI_Rn02_00288121 predicted 559
7 SASI_Rn02_00288122 predicted 328
8 SASI_Rn02_00288123 predicted 302
9 SASI_Rn02_00288124 predicted 270
10 SASI_Rn02_00288125 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027111 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331546 predicted 260
2 SASI_Mm02_00331547 predicted 435
3 SASI_Mm02_00331548 predicted 237
4 SASI_Mm02_00331549 predicted 215
5 SASI_Mm02_00331550 predicted 460
6 SASI_Mm02_00331551 predicted 221
7 SASI_Mm02_00331552 predicted 527
8 SASI_Mm02_00331553 predicted 345
9 SASI_Mm02_00331554 predicted 238
10 SASI_Mm02_00331555 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271608 predicted 268
2 SASI_Mm01_00271609 predicted 242
3 SASI_Mm01_00271610 predicted 554
4 SASI_Mm01_00271611 predicted 219
5 SASI_Mm01_00271612 predicted 229
6 SASI_Mm01_00271613 predicted 531
7 SASI_Mm01_00271614 predicted 352
8 SASI_Mm01_00271615 predicted 542
9 SASI_Mm01_00271616 predicted 562
10 SASI_Mm01_00271617 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265892 predicted 237
2 SASI_Mm01_00265893 predicted 227
3 SASI_Mm01_00265894 predicted 220
4 SASI_Mm01_00265895 predicted 218
5 SASI_Mm01_00265896 predicted 277
6 SASI_Mm01_00265897 predicted 238
7 SASI_Mm01_00265898 predicted 236
8 SASI_Mm01_00265899 predicted 249
9 SASI_Mm01_00265900 predicted 220
10 SASI_Mm01_00265901 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174898
LYG1 MISSION shRNA Bacterial Glycerol Stock
lysozyme G-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174898.2-830s21c1
Sequence:CCGGTTCTAACATCTCAGATGAAACCTCGAGGTTTCATCTGAGATGTTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174898.2-644s21c1
Sequence:CCGGGAAGTTCTGACTACTAGAATCCTCGAGGATTCTAGTAGTCAGAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174898.2-547s21c1
Sequence:CCGGTCTGGTCAACATGGGCGATAGCTCGAGCTATCGCCCATGTTGACCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174898.1-445s1c1
Sequence:CCGGCCTGAAATATCAACCCATGATCTCGAGATCATGGGTTGATATTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174898.1-806s1c1
Sequence:CCGGGCCAAGTACCTCAAGAGACATCTCGAGATGTCTCTTGAGGTACTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174898.1-408s1c1
Sequence:CCGGCTTCTGAAAGGCTGGCTGAAACTCGAGTTTCAGCCAGCCTTTCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174898.1-861s1c1
Sequence:CCGGGATCACATATGCAGCCTCAAACTCGAGTTTGAGGCTGCATATGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174898.1-327s1c1
Sequence:CCGGGAAACATCCAAAGCCTGGACACTCGAGTGTCCAGGCTTTGGATGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174898
LYG1 MISSION shRNA shRNA Plasmid DNA
lysozyme G-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174898.2-830s21c1
Sequence:CCGGTTCTAACATCTCAGATGAAACCTCGAGGTTTCATCTGAGATGTTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174898.2-644s21c1
Sequence:CCGGGAAGTTCTGACTACTAGAATCCTCGAGGATTCTAGTAGTCAGAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174898.2-547s21c1
Sequence:CCGGTCTGGTCAACATGGGCGATAGCTCGAGCTATCGCCCATGTTGACCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174898.1-445s1c1
Sequence:CCGGCCTGAAATATCAACCCATGATCTCGAGATCATGGGTTGATATTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174898.1-806s1c1
Sequence:CCGGGCCAAGTACCTCAAGAGACATCTCGAGATGTCTCTTGAGGTACTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174898.1-408s1c1
Sequence:CCGGCTTCTGAAAGGCTGGCTGAAACTCGAGTTTCAGCCAGCCTTTCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174898.1-861s1c1
Sequence:CCGGGATCACATATGCAGCCTCAAACTCGAGTTTGAGGCTGCATATGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174898.1-327s1c1
Sequence:CCGGGAAACATCCAAAGCCTGGACACTCGAGTGTCCAGGCTTTGGATGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174898
LYG1 MISSION shRNA Lentiviral Transduction Particles
lysozyme G-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174898.2-830s21c1
Sequence:CCGGTTCTAACATCTCAGATGAAACCTCGAGGTTTCATCTGAGATGTTAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174898.2-644s21c1
Sequence:CCGGGAAGTTCTGACTACTAGAATCCTCGAGGATTCTAGTAGTCAGAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174898.2-547s21c1
Sequence:CCGGTCTGGTCAACATGGGCGATAGCTCGAGCTATCGCCCATGTTGACCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174898.1-445s1c1
Sequence:CCGGCCTGAAATATCAACCCATGATCTCGAGATCATGGGTTGATATTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174898.1-806s1c1
Sequence:CCGGGCCAAGTACCTCAAGAGACATCTCGAGATGTCTCTTGAGGTACTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174898.1-408s1c1
Sequence:CCGGCTTCTGAAAGGCTGGCTGAAACTCGAGTTTCAGCCAGCCTTTCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174898.1-861s1c1
Sequence:CCGGGATCACATATGCAGCCTCAAACTCGAGTTTGAGGCTGCATATGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174898.1-327s1c1
Sequence:CCGGGAAACATCCAAAGCCTGGACACTCGAGTGTCCAGGCTTTGGATGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027111
LYG1 MISSION shRNA Bacterial Glycerol Stock
lysozyme G-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-559s21c1
Sequence:CCGGCCTAACTTTGTCCGAAGCAACCTCGAGGTTGCTTCGGACAAAGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-229s21c1
Sequence:CCGGGCCGAAGTTGACAGGCCATATCTCGAGATATGGCCTGTCAACTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-535s21c1
Sequence:CCGGGGACTCTGTGCCTATAGTAAACTCGAGTTTACTATAGGCACAGAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-464s21c1
Sequence:CCGGCTCTGACATCTAGCATCAAAGCTCGAGCTTTGATGCTAGATGTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-335s21c1
Sequence:CCGGAGTCTCCAGGAGGCAACTATGCTCGAGCATAGTTGCCTCCTGGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027111
LYG1 MISSION shRNA shRNA Plasmid DNA
lysozyme G-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-559s21c1
Sequence:CCGGCCTAACTTTGTCCGAAGCAACCTCGAGGTTGCTTCGGACAAAGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-229s21c1
Sequence:CCGGGCCGAAGTTGACAGGCCATATCTCGAGATATGGCCTGTCAACTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-535s21c1
Sequence:CCGGGGACTCTGTGCCTATAGTAAACTCGAGTTTACTATAGGCACAGAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-464s21c1
Sequence:CCGGCTCTGACATCTAGCATCAAAGCTCGAGCTTTGATGCTAGATGTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-335s21c1
Sequence:CCGGAGTCTCCAGGAGGCAACTATGCTCGAGCATAGTTGCCTCCTGGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027111
LYG1 MISSION shRNA Lentiviral Transduction Particles
lysozyme G-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-559s21c1
Sequence:CCGGCCTAACTTTGTCCGAAGCAACCTCGAGGTTGCTTCGGACAAAGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-229s21c1
Sequence:CCGGGCCGAAGTTGACAGGCCATATCTCGAGATATGGCCTGTCAACTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-535s21c1
Sequence:CCGGGGACTCTGTGCCTATAGTAAACTCGAGTTTACTATAGGCACAGAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-464s21c1
Sequence:CCGGCTCTGACATCTAGCATCAAAGCTCGAGCTTTGATGCTAGATGTCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027111.3-335s21c1
Sequence:CCGGAGTCTCCAGGAGGCAACTATGCTCGAGCATAGTTGCCTCCTGGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)