EMAIL THIS PAGE TO A FRIEND

LYG2

lysozyme G-like 2

73 Gene Product Result for
Synonyms: LYGH
UniProtKB ID: Q86SG7, Q53RW0
Gene ID:
Human(254773) Summary: The protein encoded by this gene contains a SLT domain, a protein domain present in bacterial lytic transglycosylase (SLT) and in eukaryotic lysozymes (GEWL). SLT domain catalyzes the cleavage of the beta-1,4-glycosidic bond between N-acetylmuramic acid (MurNAc) and N-acetyglucosamine (GlcNAc). [provided by RefSeq, Jul 2008]
Mouse(332427) lysozyme G-like 2
Rat(503253) lysozyme G-like 2
sheep(101106835) lysozyme G-like 2
naked mole-rat(101698196) lysozyme G-like 2
domestic guinea pig(100721432) lysozyme G-like 2
chicken(395708) lysozyme G-like 2
dog(481338) lysozyme G-like 2
domestic cat(101086895) lysozyme G-like 2
cow(536852) lysozyme G-like 2
Horse(100050656) lysozyme G-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175735 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175735 Rosetta Predictions human pricing
XM_001057909 Rosetta Predictions rat pricing
XM_578787 Rosetta Predictions rat pricing
NM_001033427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172581 predicted 213
2 SASI_Hs01_00172583 predicted 474
3 SASI_Hs01_00172584 predicted 547
4 SASI_Hs01_00172585 predicted 418
5 SASI_Hs01_00172586 predicted 345
6 SASI_Hs01_00172587 predicted 549
7 SASI_Hs02_00369078 predicted 405
8 SASI_Hs01_00172588 predicted 466
9 SASI_Hs02_00369079 predicted 483
10 SASI_Hs01_00172589 predicted 480
11 SASI_Hs01_00172582 predicted 271
12 SASI_Hs01_00172590 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287933 predicted 221
2 SASI_Rn02_00287934 predicted 364
3 SASI_Rn02_00287935 predicted 364
4 SASI_Rn02_00287936 predicted 299
5 SASI_Rn02_00287937 predicted 233
6 SASI_Rn02_00287938 predicted 239
7 SASI_Rn02_00287939 predicted 230
8 SASI_Rn02_00287940 predicted 370
9 SASI_Rn02_00287941 predicted 210
10 SASI_Rn02_00287942 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408336 predicted 639
2 SASI_Rn02_00408337 predicted 781
3 SASI_Rn02_00408338 predicted 472
4 SASI_Rn02_00408339 predicted 647
5 SASI_Rn02_00408340 predicted 475
6 SASI_Rn02_00408341 predicted 623
7 SASI_Rn02_00408342 predicted 608
8 SASI_Rn02_00408343 predicted 568
9 SASI_Rn02_00408344 predicted 276
10 SASI_Rn02_00408345 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058507 predicted 1219
2 SASI_Mm01_00058508 predicted 684
3 SASI_Mm01_00058509 predicted 720
4 SASI_Mm01_00058510 predicted 654
5 SASI_Mm01_00058511 predicted 866
6 SASI_Mm01_00058512 predicted 796
7 SASI_Mm01_00058513 predicted 1186
8 SASI_Mm01_00058514 predicted 1097
9 SASI_Mm01_00058515 predicted 1045
10 SASI_Mm01_00058516 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175735
LYG2 MISSION shRNA Bacterial Glycerol Stock
lysozyme G-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-264s1c1
Sequence:CCGGGCCACTTGTGATGCAAACAGTCTCGAGACTGTTTGCATCACAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-348s1c1
Sequence:CCGGCCTTACCAGACTCTGATCAAACTCGAGTTTGATCAGAGTCTGGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-266s1c1
Sequence:CCGGCACTTGTGATGCAAACAGTGTCTCGAGACACTGTTTGCATCACAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-177s1c1
Sequence:CCGGCCCTTCAGTCACTCAATGAAGCTCGAGCTTCATTGAGTGACTGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-498s1c1
Sequence:CCGGGATAAACAAACGTACCACCCTCTCGAGAGGGTGGTACGTTTGTTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175735.3-692s21c1
Sequence:CCGGCAATGACTTCGTCAATGATATCTCGAGATATCATTGACGAAGTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175735.3-551s21c1
Sequence:CCGGACAGGCTACTGGGATTCTAACCTCGAGGTTAGAATCCCAGTAGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175735.3-652s21c1
Sequence:CCGGAGTCAGGAATTGAAGCGATTGCTCGAGCAATCGCTTCAATTCCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175735
LYG2 MISSION shRNA shRNA Plasmid DNA
lysozyme G-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-264s1c1
Sequence:CCGGGCCACTTGTGATGCAAACAGTCTCGAGACTGTTTGCATCACAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-348s1c1
Sequence:CCGGCCTTACCAGACTCTGATCAAACTCGAGTTTGATCAGAGTCTGGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-266s1c1
Sequence:CCGGCACTTGTGATGCAAACAGTGTCTCGAGACACTGTTTGCATCACAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-177s1c1
Sequence:CCGGCCCTTCAGTCACTCAATGAAGCTCGAGCTTCATTGAGTGACTGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-498s1c1
Sequence:CCGGGATAAACAAACGTACCACCCTCTCGAGAGGGTGGTACGTTTGTTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175735.3-692s21c1
Sequence:CCGGCAATGACTTCGTCAATGATATCTCGAGATATCATTGACGAAGTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175735.3-551s21c1
Sequence:CCGGACAGGCTACTGGGATTCTAACCTCGAGGTTAGAATCCCAGTAGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175735.3-652s21c1
Sequence:CCGGAGTCAGGAATTGAAGCGATTGCTCGAGCAATCGCTTCAATTCCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175735
LYG2 MISSION shRNA Lentiviral Transduction Particles
lysozyme G-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-264s1c1
Sequence:CCGGGCCACTTGTGATGCAAACAGTCTCGAGACTGTTTGCATCACAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-348s1c1
Sequence:CCGGCCTTACCAGACTCTGATCAAACTCGAGTTTGATCAGAGTCTGGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-266s1c1
Sequence:CCGGCACTTGTGATGCAAACAGTGTCTCGAGACACTGTTTGCATCACAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-177s1c1
Sequence:CCGGCCCTTCAGTCACTCAATGAAGCTCGAGCTTCATTGAGTGACTGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175735.3-498s1c1
Sequence:CCGGGATAAACAAACGTACCACCCTCTCGAGAGGGTGGTACGTTTGTTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175735.3-692s21c1
Sequence:CCGGCAATGACTTCGTCAATGATATCTCGAGATATCATTGACGAAGTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175735.3-551s21c1
Sequence:CCGGACAGGCTACTGGGATTCTAACCTCGAGGTTAGAATCCCAGTAGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175735.3-652s21c1
Sequence:CCGGAGTCAGGAATTGAAGCGATTGCTCGAGCAATCGCTTCAATTCCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033427
LYG2 MISSION shRNA Bacterial Glycerol Stock
lysozyme G-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033427.3-1976s21c1
Sequence:CCGGTGGCTCCGTGATACGAAATTACTCGAGTAATTTCGTATCACGGAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033427.3-332s21c1
Sequence:CCGGGCACTGCCAAGGGCTCATATACTCGAGTATATGAGCCCTTGGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033427.3-474s21c1
Sequence:CCGGTGGGATCCACGGTTCGGAAATCTCGAGATTTCCGAACCGTGGATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033427.3-924s21c1
Sequence:CCGGCTTCTAGGTAGAGCGAGTTACCTCGAGGTAACTCGCTCTACCTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033427.3-729s21c1
Sequence:CCGGACAGTCTGTTGGGATTCTAACCTCGAGGTTAGAATCCCAACAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033427
LYG2 MISSION shRNA shRNA Plasmid DNA
lysozyme G-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033427.3-1976s21c1
Sequence:CCGGTGGCTCCGTGATACGAAATTACTCGAGTAATTTCGTATCACGGAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033427.3-332s21c1
Sequence:CCGGGCACTGCCAAGGGCTCATATACTCGAGTATATGAGCCCTTGGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033427.3-474s21c1
Sequence:CCGGTGGGATCCACGGTTCGGAAATCTCGAGATTTCCGAACCGTGGATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033427.3-924s21c1
Sequence:CCGGCTTCTAGGTAGAGCGAGTTACCTCGAGGTAACTCGCTCTACCTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033427.3-729s21c1
Sequence:CCGGACAGTCTGTTGGGATTCTAACCTCGAGGTTAGAATCCCAACAGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033427
LYG2 MISSION shRNA Lentiviral Transduction Particles
lysozyme G-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033427.3-1976s21c1
Sequence:CCGGTGGCTCCGTGATACGAAATTACTCGAGTAATTTCGTATCACGGAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033427.3-332s21c1
Sequence:CCGGGCACTGCCAAGGGCTCATATACTCGAGTATATGAGCCCTTGGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033427.3-474s21c1
Sequence:CCGGTGGGATCCACGGTTCGGAAATCTCGAGATTTCCGAACCGTGGATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033427.3-924s21c1
Sequence:CCGGCTTCTAGGTAGAGCGAGTTACCTCGAGGTAACTCGCTCTACCTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033427.3-729s21c1
Sequence:CCGGACAGTCTGTTGGGATTCTAACCTCGAGGTTAGAATCCCAACAGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)