EMAIL THIS PAGE TO A FRIEND

LYL1

lymphoblastic leukemia derived sequence 1

58 Gene Product Result for
Synonyms: bHLHa18
UniProtKB ID: P12980, O76102
Gene ID:
Human(4066) Summary: This gene represents a basic helix-loop-helix transcription factor. The encoded protein may play roles in blood vessel maturation and hematopoeisis. A translocation between this locus and the T cell receptor beta locus (GeneID 6957) on chromosome 7 has been associated with acute lymphoblastic leukemia. [provided by RefSeq, Sep 2010]
Mouse(17095) lymphoblastomic leukemia 1
Rat(304663) lymphoblastic leukemia derived sequence 1
cow(281286) lymphoblastic leukemia derived sequence 1
domestic cat(101094082) lymphoblastic leukemia derived sequence 1
cow(615458) lymphoblastic leukemia derived sequence 1
dog(610908) lymphoblastic leukemia derived sequence 1
domestic guinea pig(100726829) lymphoblastic leukemia derived sequence 1
naked mole-rat(101721619) lymphoblastic leukemia derived sequence 1
sheep(101121935) lymphoblastic leukemia derived sequence 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008535 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008535 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008535 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005583 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005583 Rosetta Predictions human pricing
NM_001007677 Rosetta Predictions rat pricing
XM_001071678 Rosetta Predictions rat pricing
NM_008535 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163066 predicted 1152
2 SASI_Hs01_00163067 predicted 940
3 SASI_Hs01_00163068 predicted 1151
4 SASI_Hs01_00163069 predicted 742
5 SASI_Hs01_00163070 predicted 1170
6 SASI_Hs01_00163071 predicted 1172
7 SASI_Hs01_00163072 predicted 739
8 SASI_Hs01_00163073 predicted 902
9 SASI_Hs01_00163074 predicted 1171
10 SASI_Hs01_00163075 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110502 predicted 269
2 SASI_Rn01_00110503 predicted 506
3 SASI_Rn01_00110504 predicted 1191
4 SASI_Rn01_00110505 predicted 1207
5 SASI_Rn02_00198807 predicted 1103
6 SASI_Rn02_00198808 predicted 396
7 SASI_Rn01_00110507 predicted 791
8 SASI_Rn01_00110508 predicted 428
9 SASI_Rn01_00110509 predicted 588
10 SASI_Rn01_00110510 predicted 1117
11 SASI_Rn01_00110506 predicted 449
12 SASI_Rn01_00110511 predicted 976
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336004 predicted 598
2 SASI_Rn02_00336005 predicted 833
3 SASI_Rn02_00336006 predicted 1438
4 SASI_Rn02_00336007 predicted 1449
5 SASI_Rn02_00336008 predicted 1340
6 SASI_Rn02_00336009 predicted 1154
7 SASI_Rn02_00336010 predicted 718
8 SASI_Rn02_00336011 predicted 1116
9 SASI_Rn02_00336012 predicted 749
10 SASI_Rn02_00336013 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314128 predicted 1402
2 SASI_Mm01_00081016 predicted 950
3 SASI_Mm01_00081023 predicted 1334
4 SASI_Mm01_00081017 predicted 1346
5 SASI_Mm01_00081018 predicted 838
6 SASI_Mm01_00081019 predicted 1543
7 SASI_Mm01_00081020 predicted 1437
8 SASI_Mm01_00081022 predicted 602
9 SASI_Mm01_00081024 predicted 848
10 SASI_Mm02_00314129 predicted 1438
11 SASI_Mm01_00081015 predicted 1322
12 SASI_Mm01_00081021 predicted 1334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008535
LYL1 MISSION shRNA Bacterial Glycerol Stock
lymphoblastic leukemia derived sequence 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008535.2-878s21c1
Sequence:CCGGTCCTCAACAGTGTCTACATTGCTCGAGCAATGTAGACACTGTTGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008535.2-1419s21c1
Sequence:CCGGGTTCAGTGAACTCCCTGTAAACTCGAGTTTACAGGGAGTTCACTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008535.2-1127s21c1
Sequence:CCGGTGCGCCTGGCCATGAAGTATACTCGAGTATACTTCATGGCCAGGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008535.2-1537s21c1
Sequence:CCGGAGGCTACTTGCAGTGGCTTTGCTCGAGCAAAGCCACTGCAAGTAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008535.1-1329s1c1
Sequence:CCGGGCTCAGTGAACTCCCTGTAAACTCGAGTTTACAGGGAGTTCACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008535.1-644s1c1
Sequence:CCGGCAGTGATAAACCTGGGACACACTCGAGTGTGTCCCAGGTTTATCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008535.1-1259s1c1
Sequence:CCGGCCATCAAGTTGGAGCAGACATCTCGAGATGTCTGCTCCAACTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008535.1-831s1c1
Sequence:CCGGCTTCCCTAACAGCCGGCTGAACTCGAGTTCAGCCGGCTGTTAGGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008535.1-1198s1c1
Sequence:CCGGGCACGCTCACAGCCCGTGCTTCTCGAGAAGCACGGGCTGTGAGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008535
LYL1 MISSION shRNA shRNA Plasmid DNA
lymphoblastic leukemia derived sequence 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008535.2-878s21c1
Sequence:CCGGTCCTCAACAGTGTCTACATTGCTCGAGCAATGTAGACACTGTTGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008535.2-1419s21c1
Sequence:CCGGGTTCAGTGAACTCCCTGTAAACTCGAGTTTACAGGGAGTTCACTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008535.2-1127s21c1
Sequence:CCGGTGCGCCTGGCCATGAAGTATACTCGAGTATACTTCATGGCCAGGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008535.2-1537s21c1
Sequence:CCGGAGGCTACTTGCAGTGGCTTTGCTCGAGCAAAGCCACTGCAAGTAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008535.1-1329s1c1
Sequence:CCGGGCTCAGTGAACTCCCTGTAAACTCGAGTTTACAGGGAGTTCACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008535.1-644s1c1
Sequence:CCGGCAGTGATAAACCTGGGACACACTCGAGTGTGTCCCAGGTTTATCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008535.1-1259s1c1
Sequence:CCGGCCATCAAGTTGGAGCAGACATCTCGAGATGTCTGCTCCAACTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008535.1-831s1c1
Sequence:CCGGCTTCCCTAACAGCCGGCTGAACTCGAGTTCAGCCGGCTGTTAGGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008535.1-1198s1c1
Sequence:CCGGGCACGCTCACAGCCCGTGCTTCTCGAGAAGCACGGGCTGTGAGCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008535
LYL1 MISSION shRNA Lentiviral Transduction Particles
lymphoblastic leukemia derived sequence 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008535.2-878s21c1
Sequence:CCGGTCCTCAACAGTGTCTACATTGCTCGAGCAATGTAGACACTGTTGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008535.2-1419s21c1
Sequence:CCGGGTTCAGTGAACTCCCTGTAAACTCGAGTTTACAGGGAGTTCACTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008535.2-1127s21c1
Sequence:CCGGTGCGCCTGGCCATGAAGTATACTCGAGTATACTTCATGGCCAGGCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008535.2-1537s21c1
Sequence:CCGGAGGCTACTTGCAGTGGCTTTGCTCGAGCAAAGCCACTGCAAGTAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008535.1-1329s1c1
Sequence:CCGGGCTCAGTGAACTCCCTGTAAACTCGAGTTTACAGGGAGTTCACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008535.1-644s1c1
Sequence:CCGGCAGTGATAAACCTGGGACACACTCGAGTGTGTCCCAGGTTTATCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008535.1-1259s1c1
Sequence:CCGGCCATCAAGTTGGAGCAGACATCTCGAGATGTCTGCTCCAACTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008535.1-831s1c1
Sequence:CCGGCTTCCCTAACAGCCGGCTGAACTCGAGTTCAGCCGGCTGTTAGGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008535.1-1198s1c1
Sequence:CCGGGCACGCTCACAGCCCGTGCTTCTCGAGAAGCACGGGCTGTGAGCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005583
LYL1 MISSION shRNA Bacterial Glycerol Stock
lymphoblastic leukemia derived sequence 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005583.3-1314s21c1
Sequence:CCGGGAAGGACCAGTGAAGACGTCACTCGAGTGACGTCTTCACTGGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005583.3-655s21c1
Sequence:CCGGCACTTTGGCCCTGCACTACCACTCGAGTGGTAGTGCAGGGCCAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005583.3-408s21c1
Sequence:CCGGAGAAGGCAGAGATGGTGTGTGCTCGAGCACACACCATCTCTGCCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005583.3-1258s1c1
Sequence:CCGGCGTCAAGGAAAGGGCAGTGGACTCGAGTCCACTGCCCTTTCCTTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005583.3-685s1c1
Sequence:CCGGCTTCCTCAACAGTGTCTACATCTCGAGATGTAGACACTGTTGAGGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005583.3-741s1c1
Sequence:CCGGGCCGGTTGAAGCGGAGACCAACTCGAGTTGGTCTCCGCTTCAACCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005583.3-1167s1c1
Sequence:CCGGAGATGGAGCAAACCGCTTTGACTCGAGTCAAAGCGGTTTGCTCCATCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005583.3-943s1c1
Sequence:CCGGAGCCATGAAGTACATCGGCTTCTCGAGAAGCCGATGTACTTCATGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005583
LYL1 MISSION shRNA shRNA Plasmid DNA
lymphoblastic leukemia derived sequence 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005583.3-1314s21c1
Sequence:CCGGGAAGGACCAGTGAAGACGTCACTCGAGTGACGTCTTCACTGGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005583.3-655s21c1
Sequence:CCGGCACTTTGGCCCTGCACTACCACTCGAGTGGTAGTGCAGGGCCAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005583.3-408s21c1
Sequence:CCGGAGAAGGCAGAGATGGTGTGTGCTCGAGCACACACCATCTCTGCCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005583.3-1258s1c1
Sequence:CCGGCGTCAAGGAAAGGGCAGTGGACTCGAGTCCACTGCCCTTTCCTTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005583.3-685s1c1
Sequence:CCGGCTTCCTCAACAGTGTCTACATCTCGAGATGTAGACACTGTTGAGGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005583.3-741s1c1
Sequence:CCGGGCCGGTTGAAGCGGAGACCAACTCGAGTTGGTCTCCGCTTCAACCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005583.3-1167s1c1
Sequence:CCGGAGATGGAGCAAACCGCTTTGACTCGAGTCAAAGCGGTTTGCTCCATCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005583.3-943s1c1
Sequence:CCGGAGCCATGAAGTACATCGGCTTCTCGAGAAGCCGATGTACTTCATGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005583
LYL1 MISSION shRNA Lentiviral Transduction Particles
lymphoblastic leukemia derived sequence 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005583.3-1314s21c1
Sequence:CCGGGAAGGACCAGTGAAGACGTCACTCGAGTGACGTCTTCACTGGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005583.3-655s21c1
Sequence:CCGGCACTTTGGCCCTGCACTACCACTCGAGTGGTAGTGCAGGGCCAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005583.3-408s21c1
Sequence:CCGGAGAAGGCAGAGATGGTGTGTGCTCGAGCACACACCATCTCTGCCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017538    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005583.3-1258s1c1
Sequence:CCGGCGTCAAGGAAAGGGCAGTGGACTCGAGTCCACTGCCCTTTCCTTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005583.3-685s1c1
Sequence:CCGGCTTCCTCAACAGTGTCTACATCTCGAGATGTAGACACTGTTGAGGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005583.3-741s1c1
Sequence:CCGGGCCGGTTGAAGCGGAGACCAACTCGAGTTGGTCTCCGCTTCAACCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005583.3-1167s1c1
Sequence:CCGGAGATGGAGCAAACCGCTTTGACTCGAGTCAAAGCGGTTTGCTCCATCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005583.3-943s1c1
Sequence:CCGGAGCCATGAAGTACATCGGCTTCTCGAGAAGCCGATGTACTTCATGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)