EMAIL THIS PAGE TO A FRIEND

LYN

v-yes-1 Yamaguchi sarcoma viral related oncogene homolog

122 Gene Product Result for
Synonyms: JTK8 p53Lyn p56Lyn
UniProtKB ID: P07948, A0AVQ5
Gene ID:
Human(4067) Summary: This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Mouse(17096) Yamaguchi sarcoma viral (v-yes-1) oncogene homolog
Rat(81515) v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
Zebrafish(447804) v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
chicken(421127) v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
dog(477886) v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
domestic cat(101096633) v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
cow(534996) v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
Horse(100053129) v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
sheep(100302103) v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
naked mole-rat(101696753) v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
domestic guinea pig(100714653) v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
L2919 Anti-LYN (51-65) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500608 Anti-LYN antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, human
ELISA, western blot pricing
SAB1406095 Anti-LYN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA001231 Anti-LYN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation rat, mouse, human
immunohistochemistry, western blot pricing
SAB4501792 Anti-LYN antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB2107070 Anti-LYN antibody produced in rabbit affinity isolated antibody horse, rabbit, mouse, guinea pig, sheep, human
western blot pricing
SAB1410763 Anti-LYN antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
SAB1304718 ANTI-MOUSE LYN (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4503823 Anti-phospho-Lyn (pTyr507) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4200286 Monoclonal Anti-LYN antibody produced in mouse ~1.0 mg/mL, clone LYN-27, purified immunoglobulin mouse, human
immunocytochemistry, western blot pricing
SAB5300434 Monoclonal Anti-LYN antibody produced in mouse clone 2H8D7, ascites fluid human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
E2250 Ellagic acid ≥95% (HPLC), powder, from tree bark human, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB0976 Phosphotyrosine LYN / Tyrosine-protein Kinase Lyn ELISA Kit human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0425 AQUA Peptide GSLLDFL[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002350 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010747 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010747 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010747 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089961 MISSION® esiRNA esiRNA human LYN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111097 Rosetta Predictions human pricing
NM_002350 siRNAs that have been validated in the lab human pricing
NM_001111098 Rosetta Predictions rat pricing
NM_030857 Rosetta Predictions rat pricing
NM_001111096 Rosetta Predictions mouse pricing
NM_010747 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325236 predicted 1321
2 SASI_Hs02_00325237 predicted 747
3 SASI_Hs02_00325238 predicted 1627
4 SASI_Hs02_00325239 predicted 1190
5 SASI_Hs02_00325240 predicted 888
6 SASI_Hs02_00325241 predicted 1058
7 SASI_Hs02_00325242 predicted 1558
8 SASI_Hs02_00325243 predicted 560
9 SASI_Hs02_00325244 predicted 1520
10 SASI_Hs02_00325245 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002350 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181774 validated 1249
1 SASI_Hs01_00181772 validated 805
2 SASI_Hs02_00333679 predicted 1389
3 SASI_Hs01_00181773 predicted 1688
4 SASI_Hs01_00181776 predicted 957
5 SASI_Hs01_00181777 predicted 1117
6 SASI_Hs01_00181779 predicted 1618
7 SASI_Hs01_00181780 predicted 621
8 SASI_Hs01_00181781 predicted 1576
9 SASI_Hs02_00333680 predicted 851
10 SASI_Hs01_00181775 predicted 561
11 SASI_Hs01_00181778 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111098 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251482 predicted 806
2 SASI_Rn02_00251483 predicted 783
3 SASI_Rn02_00251484 predicted 617
4 SASI_Rn02_00251485 predicted 1402
5 SASI_Rn02_00251486 predicted 1227
6 SASI_Rn02_00251487 predicted 1631
7 SASI_Rn02_00251488 predicted 1507
8 SASI_Rn02_00251489 predicted 1172
9 SASI_Rn02_00251490 predicted 1328
10 SASI_Rn02_00251491 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091440 predicted 838
2 SASI_Rn01_00091441 predicted 424
3 SASI_Rn01_00091442 predicted 259
4 SASI_Rn02_00264103 predicted 1464
5 SASI_Rn01_00091443 predicted 1295
6 SASI_Rn01_00091444 predicted 1572
7 SASI_Rn01_00091445 predicted 295
8 SASI_Rn01_00091446 predicted 1234
9 SASI_Rn01_00091447 predicted 1398
10 SASI_Rn01_00091448 predicted 256
11 SASI_Rn01_00091449 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306382 predicted 884
2 SASI_Mm02_00306383 predicted 857
3 SASI_Mm02_00306384 predicted 1307
4 SASI_Mm02_00306385 predicted 1533
5 SASI_Mm02_00306386 predicted 773
6 SASI_Mm02_00306387 predicted 702
7 SASI_Mm02_00306388 predicted 737
8 SASI_Mm02_00306389 predicted 859
9 SASI_Mm02_00306390 predicted 1486
10 SASI_Mm02_00306391 predicted 1654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319256 predicted 819
2 SASI_Mm01_00166583 predicted 794
3 SASI_Mm01_00166584 predicted 1244
4 SASI_Mm01_00166587 predicted 1469
5 SASI_Mm02_00319257 predicted 708
6 SASI_Mm01_00166589 predicted 640
7 SASI_Mm02_00319258 predicted 679
8 SASI_Mm02_00319259 predicted 796
9 SASI_Mm02_00319260 predicted 1426
10 SASI_Mm02_00319261 predicted 1596
11 SASI_Mm01_00166581 predicted 1723
12 SASI_Mm01_00166582 predicted 417
13 SASI_Mm01_00166585 predicted 1741
14 SASI_Mm01_00166586 predicted 490
15 SASI_Mm01_00166588 predicted 374
16 SASI_Mm01_00166590 predicted 1160
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002350
VALIDATED
LYN MISSION shRNA Bacterial Glycerol Stock
v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002350.1-333s1c1
Sequence:CCGGGAGTGACGATGGAGTAGATTTCTCGAGAAATCTACTCCATCGTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002350.1-1999s1c1
Sequence:CCGGGAAAGTATTCTGTACTCTTAGCTCGAGCTAAGAGTACAGAATACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002350.1-1537s1c1
Sequence:CCGGGCAATCAACTTTGGATGTTTCCTCGAGGAAACATCCAAAGTTGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-1161s1c1
Sequence:CCGGGGAAGAAGCCAACCTCATGAACTCGAGTTCATGAGGTTGGCTTCTTCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-1747s1c1
Sequence:CCGGGCAGAAGAGAGACCAACGTTTCTCGAGAAACGTTGGTCTCTCTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-1599s1c1
Sequence:CCGGCGAAATTGTCACCTATGGGAACTCGAGTTCCCATAGGTGACAATTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-652s1c1
Sequence:CCGGGCCAAACTCAACACCTTAGAACTCGAGTTCTAAGGTGTTGAGTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-872s1c1
Sequence:CCGGGCTATTACATCTCTCCACGAACTCGAGTTCGTGGAGAGATGTAATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002350.2-318s21c1
Sequence:CCGGGAGTGACGATGGAGTAGATTTCTCGAGAAATCTACTCCATCGTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002350.2-341s1c1
Sequence:CCGGAGACTCAACCAGTACGTAATACTCGAGTATTACGTACTGGTTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002350.2-1570s21c1
Sequence:GTACCGGGGAATCCTCCTATACGAAATTCTCGAGAATTTCGTATAGGAGGATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002350.2-2863s1c1
Sequence:CCGGGCATGTGTATGAGACTATTTACTCGAGTAAATAGTCTCATACACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002350.2-341s21c1
Sequence:CCGGAGACTCAACCAGTACGTAATACTCGAGTATTACGTACTGGTTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002350.2-2863s21c1
Sequence:CCGGGCATGTGTATGAGACTATTTACTCGAGTAAATAGTCTCATACACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002350
VALIDATED
LYN MISSION shRNA shRNA Plasmid DNA
v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002350.1-333s1c1
Sequence:CCGGGAGTGACGATGGAGTAGATTTCTCGAGAAATCTACTCCATCGTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002350.1-1999s1c1
Sequence:CCGGGAAAGTATTCTGTACTCTTAGCTCGAGCTAAGAGTACAGAATACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002350.1-1537s1c1
Sequence:CCGGGCAATCAACTTTGGATGTTTCCTCGAGGAAACATCCAAAGTTGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-1161s1c1
Sequence:CCGGGGAAGAAGCCAACCTCATGAACTCGAGTTCATGAGGTTGGCTTCTTCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-1747s1c1
Sequence:CCGGGCAGAAGAGAGACCAACGTTTCTCGAGAAACGTTGGTCTCTCTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-1599s1c1
Sequence:CCGGCGAAATTGTCACCTATGGGAACTCGAGTTCCCATAGGTGACAATTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-652s1c1
Sequence:CCGGGCCAAACTCAACACCTTAGAACTCGAGTTCTAAGGTGTTGAGTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-872s1c1
Sequence:CCGGGCTATTACATCTCTCCACGAACTCGAGTTCGTGGAGAGATGTAATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002350.2-318s21c1
Sequence:CCGGGAGTGACGATGGAGTAGATTTCTCGAGAAATCTACTCCATCGTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002350.2-341s1c1
Sequence:CCGGAGACTCAACCAGTACGTAATACTCGAGTATTACGTACTGGTTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002350.2-1570s21c1
Sequence:GTACCGGGGAATCCTCCTATACGAAATTCTCGAGAATTTCGTATAGGAGGATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002350.2-2863s1c1
Sequence:CCGGGCATGTGTATGAGACTATTTACTCGAGTAAATAGTCTCATACACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002350.2-341s21c1
Sequence:CCGGAGACTCAACCAGTACGTAATACTCGAGTATTACGTACTGGTTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002350.2-2863s21c1
Sequence:CCGGGCATGTGTATGAGACTATTTACTCGAGTAAATAGTCTCATACACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002350
VALIDATED
LYN MISSION shRNA Lentiviral Transduction Particles
v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002350.1-333s1c1
Sequence:CCGGGAGTGACGATGGAGTAGATTTCTCGAGAAATCTACTCCATCGTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196254    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002350.1-1999s1c1
Sequence:CCGGGAAAGTATTCTGTACTCTTAGCTCGAGCTAAGAGTACAGAATACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002350.1-1537s1c1
Sequence:CCGGGCAATCAACTTTGGATGTTTCCTCGAGGAAACATCCAAAGTTGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-1161s1c1
Sequence:CCGGGGAAGAAGCCAACCTCATGAACTCGAGTTCATGAGGTTGGCTTCTTCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-1747s1c1
Sequence:CCGGGCAGAAGAGAGACCAACGTTTCTCGAGAAACGTTGGTCTCTCTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-1599s1c1
Sequence:CCGGCGAAATTGTCACCTATGGGAACTCGAGTTCCCATAGGTGACAATTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-652s1c1
Sequence:CCGGGCCAAACTCAACACCTTAGAACTCGAGTTCTAAGGTGTTGAGTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002350.x-872s1c1
Sequence:CCGGGCTATTACATCTCTCCACGAACTCGAGTTCGTGGAGAGATGTAATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002350.2-318s21c1
Sequence:CCGGGAGTGACGATGGAGTAGATTTCTCGAGAAATCTACTCCATCGTCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002350.2-341s1c1
Sequence:CCGGAGACTCAACCAGTACGTAATACTCGAGTATTACGTACTGGTTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002350.2-1570s21c1
Sequence:GTACCGGGGAATCCTCCTATACGAAATTCTCGAGAATTTCGTATAGGAGGATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002350.2-2863s1c1
Sequence:CCGGGCATGTGTATGAGACTATTTACTCGAGTAAATAGTCTCATACACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002350.2-341s21c1
Sequence:CCGGAGACTCAACCAGTACGTAATACTCGAGTATTACGTACTGGTTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002350.2-2863s21c1
Sequence:CCGGGCATGTGTATGAGACTATTTACTCGAGTAAATAGTCTCATACACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010747
VALIDATED
LYN MISSION shRNA Bacterial Glycerol Stock
v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010747.1-798s1c1
Sequence:CCGGGACATGATTAAGCATTACCAACTCGAGTTGGTAATGCTTAATCATGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010747.1-1311s1c1
Sequence:CCGGGAGTCACTCATGTGCAAGATTCTCGAGAATCTTGCACATGAGTGACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010747.1-387s1c1
Sequence:CCGGGTGGCCTTATACCCTTATGATCTCGAGATCATAAGGGTATAAGGCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010747.1-537s1c1
Sequence:CCGGGCCAAGGTCAACACCTTAGAACTCGAGTTCTAAGGTGTTGACCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010747.1-1346s1c1
Sequence:CCGGCGCGAGAGTCATCGAAGATAACTCGAGTTATCTTCGATGACTCTCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010747.2-802s21c1
Sequence:CCGGGACATGATTAAGCATTACCAACTCGAGTTGGTAATGCTTAATCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010747.2-541s21c1
Sequence:CCGGGCCAAGGTCAACACCTTAGAACTCGAGTTCTAAGGTGTTGACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010747.2-1350s21c1
Sequence:CCGGCGCGAGAGTCATCGAAGATAACTCGAGTTATCTTCGATGACTCTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010747.2-1315s21c1
Sequence:CCGGGAGTCACTCATGTGCAAGATTCTCGAGAATCTTGCACATGAGTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010747
VALIDATED
LYN MISSION shRNA shRNA Plasmid DNA
v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010747.1-798s1c1
Sequence:CCGGGACATGATTAAGCATTACCAACTCGAGTTGGTAATGCTTAATCATGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010747.1-1311s1c1
Sequence:CCGGGAGTCACTCATGTGCAAGATTCTCGAGAATCTTGCACATGAGTGACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010747.1-387s1c1
Sequence:CCGGGTGGCCTTATACCCTTATGATCTCGAGATCATAAGGGTATAAGGCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010747.1-537s1c1
Sequence:CCGGGCCAAGGTCAACACCTTAGAACTCGAGTTCTAAGGTGTTGACCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010747.1-1346s1c1
Sequence:CCGGCGCGAGAGTCATCGAAGATAACTCGAGTTATCTTCGATGACTCTCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010747.2-802s21c1
Sequence:CCGGGACATGATTAAGCATTACCAACTCGAGTTGGTAATGCTTAATCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010747.2-541s21c1
Sequence:CCGGGCCAAGGTCAACACCTTAGAACTCGAGTTCTAAGGTGTTGACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010747.2-1350s21c1
Sequence:CCGGCGCGAGAGTCATCGAAGATAACTCGAGTTATCTTCGATGACTCTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010747.2-1315s21c1
Sequence:CCGGGAGTCACTCATGTGCAAGATTCTCGAGAATCTTGCACATGAGTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010747
VALIDATED
LYN MISSION shRNA Lentiviral Transduction Particles
v-yes-1 Yamaguchi sarcoma viral related oncogene homolog
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010747.1-798s1c1
Sequence:CCGGGACATGATTAAGCATTACCAACTCGAGTTGGTAATGCTTAATCATGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010747.1-1311s1c1
Sequence:CCGGGAGTCACTCATGTGCAAGATTCTCGAGAATCTTGCACATGAGTGACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010747.1-387s1c1
Sequence:CCGGGTGGCCTTATACCCTTATGATCTCGAGATCATAAGGGTATAAGGCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010747.1-537s1c1
Sequence:CCGGGCCAAGGTCAACACCTTAGAACTCGAGTTCTAAGGTGTTGACCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010747.1-1346s1c1
Sequence:CCGGCGCGAGAGTCATCGAAGATAACTCGAGTTATCTTCGATGACTCTCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010747.2-802s21c1
Sequence:CCGGGACATGATTAAGCATTACCAACTCGAGTTGGTAATGCTTAATCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010747.2-541s21c1
Sequence:CCGGGCCAAGGTCAACACCTTAGAACTCGAGTTCTAAGGTGTTGACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010747.2-1350s21c1
Sequence:CCGGCGCGAGAGTCATCGAAGATAACTCGAGTTATCTTCGATGACTCTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010747.2-1315s21c1
Sequence:CCGGGAGTCACTCATGTGCAAGATTCTCGAGAATCTTGCACATGAGTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)