EMAIL THIS PAGE TO A FRIEND

LYPD1

LY6/PLAUR domain containing 1

100 Gene Product Result for
Synonyms: LYPDC1 PHTS
UniProtKB ID: Q8N2G4, H7BXW6, Q6ZP52, Q6ZWI4, Q96AC2
Gene ID:
Mouse(72585) Ly6/Plaur domain containing 1
Rat(360838) Ly6/Plaur domain containing 1
chicken(100859784) LY6/PLAUR domain containing 1
domestic cat(101088178) LY6/PLAUR domain containing 1
dog(610707) LY6/PLAUR domain containing 1
cow(533675) LY6/PLAUR domain containing 1
naked mole-rat(101719998) LY6/PLAUR domain containing 1
domestic guinea pig(100734202) LY6/PLAUR domain containing 1
Goat(100861143) LY6/PLAUR domain containing 1
sheep(101108195) LY6/PLAUR domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301426 ANTI-LYPD1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144586 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077427 Rosetta Predictions human pricing
NM_144586 Rosetta Predictions human pricing
NM_001007727 Rosetta Predictions rat pricing
NM_145100 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312534 predicted 1173
2 SASI_Hs02_00312535 predicted 754
3 SASI_Hs02_00312536 predicted 650
4 SASI_Hs02_00312537 predicted 646
5 SASI_Hs02_00312538 predicted 642
6 SASI_Hs02_00312539 predicted 1112
7 SASI_Hs02_00312540 predicted 843
8 SASI_Hs02_00312541 predicted 647
9 SASI_Hs02_00312542 predicted 1060
10 SASI_Hs02_00312543 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364371 predicted 1878
2 SASI_Hs01_00036666 predicted 1466
3 SASI_Hs01_00036672 predicted 1356
4 SASI_Hs02_00364372 predicted 1350
5 SASI_Hs02_00364373 predicted 1356
6 SASI_Hs02_00364374 predicted 1824
7 SASI_Hs02_00364375 predicted 1554
8 SASI_Hs02_00364376 predicted 1352
9 SASI_Hs02_00364377 predicted 1772
10 SASI_Hs02_00364378 predicted 1548
11 SASI_Hs01_00036667 predicted 349
12 SASI_Hs01_00036668 predicted 858
13 SASI_Hs01_00036669 predicted 1212
14 SASI_Hs01_00036670 predicted 466
15 SASI_Hs01_00036671 predicted 393
16 SASI_Hs01_00036673 predicted 359
17 SASI_Hs01_00036674 predicted 285
18 SASI_Hs01_00036675 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064723 predicted 1164
2 SASI_Rn01_00064724 predicted 1145
3 SASI_Rn02_00198912 predicted 885
4 SASI_Rn01_00064726 predicted 1059
5 SASI_Rn01_00064727 predicted 999
6 SASI_Rn01_00064728 predicted 855
7 SASI_Rn01_00064729 predicted 430
8 SASI_Rn01_00064730 predicted 1123
9 SASI_Rn01_00064731 predicted 1009
10 SASI_Rn01_00064732 predicted 989
11 SASI_Rn01_00064725 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169422 predicted 1031
2 SASI_Mm01_00169424 predicted 1163
3 SASI_Mm02_00340498 predicted 1051
4 SASI_Mm01_00169425 predicted 1090
5 SASI_Mm01_00169426 predicted 527
6 SASI_Mm01_00169428 predicted 1201
7 SASI_Mm01_00169429 predicted 400
8 SASI_Mm01_00169430 predicted 912
9 SASI_Mm01_00169431 predicted 955
10 SASI_Mm02_00340499 predicted 872
11 SASI_Mm01_00169423 predicted 597
12 SASI_Mm01_00169427 predicted 919
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144586
VALIDATED
LYPD1 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144586.3-1690s1c1
Sequence:CCGGGCATGAGAACACAGTAAATAACTCGAGTTATTTACTGTGTTCTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144586.3-541s1c1
Sequence:CCGGCCAGGGAAACTGAACTCAGTTCTCGAGAACTGAGTTCAGTTTCCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144586.3-669s1c1
Sequence:CCGGCAAATTAGCCTCTTCTCGGCACTCGAGTGCCGAGAAGAGGCTAATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_144586.5-1125s21c1
Sequence:CCGGTTCAAGACATGTGTCAGAAAGCTCGAGCTTTCTGACACATGTCTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144586.5-1103s21c1
Sequence:CCGGATTGTGAATTGCACGGTGAACCTCGAGGTTCACCGTGCAATTCACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_144586.5-2393s21c1
Sequence:CCGGAGCATGAGAACACAGTAAATGCTCGAGCATTTACTGTGTTCTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_144586.5-1024s21c1
Sequence:CCGGTCCAGGCTTTGCGCTGCAAATCTCGAGATTTGCAGCGCAAAGCCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_144586.5-1155s21c1
Sequence:CCGGAGCAAAGTGCCGGGATCATGTCTCGAGACATGATCCCGGCACTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144586
VALIDATED
LYPD1 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144586.3-1690s1c1
Sequence:CCGGGCATGAGAACACAGTAAATAACTCGAGTTATTTACTGTGTTCTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144586.3-541s1c1
Sequence:CCGGCCAGGGAAACTGAACTCAGTTCTCGAGAACTGAGTTCAGTTTCCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144586.3-669s1c1
Sequence:CCGGCAAATTAGCCTCTTCTCGGCACTCGAGTGCCGAGAAGAGGCTAATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_144586.5-1125s21c1
Sequence:CCGGTTCAAGACATGTGTCAGAAAGCTCGAGCTTTCTGACACATGTCTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144586.5-1103s21c1
Sequence:CCGGATTGTGAATTGCACGGTGAACCTCGAGGTTCACCGTGCAATTCACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_144586.5-2393s21c1
Sequence:CCGGAGCATGAGAACACAGTAAATGCTCGAGCATTTACTGTGTTCTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_144586.5-1024s21c1
Sequence:CCGGTCCAGGCTTTGCGCTGCAAATCTCGAGATTTGCAGCGCAAAGCCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_144586.5-1155s21c1
Sequence:CCGGAGCAAAGTGCCGGGATCATGTCTCGAGACATGATCCCGGCACTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144586
VALIDATED
LYPD1 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167770    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144586.3-1690s1c1
Sequence:CCGGGCATGAGAACACAGTAAATAACTCGAGTTATTTACTGTGTTCTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144586.3-541s1c1
Sequence:CCGGCCAGGGAAACTGAACTCAGTTCTCGAGAACTGAGTTCAGTTTCCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144586.3-669s1c1
Sequence:CCGGCAAATTAGCCTCTTCTCGGCACTCGAGTGCCGAGAAGAGGCTAATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_144586.5-1125s21c1
Sequence:CCGGTTCAAGACATGTGTCAGAAAGCTCGAGCTTTCTGACACATGTCTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144586.5-1103s21c1
Sequence:CCGGATTGTGAATTGCACGGTGAACCTCGAGGTTCACCGTGCAATTCACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_144586.5-2393s21c1
Sequence:CCGGAGCATGAGAACACAGTAAATGCTCGAGCATTTACTGTGTTCTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_144586.5-1024s21c1
Sequence:CCGGTCCAGGCTTTGCGCTGCAAATCTCGAGATTTGCAGCGCAAAGCCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_144586.5-1155s21c1
Sequence:CCGGAGCAAAGTGCCGGGATCATGTCTCGAGACATGATCCCGGCACTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145100
LYPD1 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145100.2-451s1c1
Sequence:CCGGCATCGTAAATTGCACCGTGAACTCGAGTTCACGGTGCAATTTACGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145100.2-419s1c1
Sequence:CCGGCAGCTGAACAACGATTGCTCACTCGAGTGAGCAATCGTTGTTCAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175231    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145100.2-871s1c1
Sequence:CCGGCCTTTCAAGTAACGCAAGATTCTCGAGAATCTTGCGTTACTTGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145100.2-455s1c1
Sequence:CCGGGTAAATTGCACCGTGAACGTTCTCGAGAACGTTCACGGTGCAATTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145100.2-481s1c1
Sequence:CCGGCATGTGTCAGAAAGAAGTGATCTCGAGATCACTTCTTTCTGACACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145100.2-488s1c1
Sequence:CCGGCAGAAAGAAGTGATGGAGCAACTCGAGTTGCTCCATCACTTCTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145100
LYPD1 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145100.2-451s1c1
Sequence:CCGGCATCGTAAATTGCACCGTGAACTCGAGTTCACGGTGCAATTTACGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145100.2-419s1c1
Sequence:CCGGCAGCTGAACAACGATTGCTCACTCGAGTGAGCAATCGTTGTTCAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175231    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145100.2-871s1c1
Sequence:CCGGCCTTTCAAGTAACGCAAGATTCTCGAGAATCTTGCGTTACTTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145100.2-455s1c1
Sequence:CCGGGTAAATTGCACCGTGAACGTTCTCGAGAACGTTCACGGTGCAATTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145100.2-481s1c1
Sequence:CCGGCATGTGTCAGAAAGAAGTGATCTCGAGATCACTTCTTTCTGACACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145100.2-488s1c1
Sequence:CCGGCAGAAAGAAGTGATGGAGCAACTCGAGTTGCTCCATCACTTCTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145100
LYPD1 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145100.2-451s1c1
Sequence:CCGGCATCGTAAATTGCACCGTGAACTCGAGTTCACGGTGCAATTTACGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145100.2-419s1c1
Sequence:CCGGCAGCTGAACAACGATTGCTCACTCGAGTGAGCAATCGTTGTTCAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175231    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145100.2-871s1c1
Sequence:CCGGCCTTTCAAGTAACGCAAGATTCTCGAGAATCTTGCGTTACTTGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145100.2-455s1c1
Sequence:CCGGGTAAATTGCACCGTGAACGTTCTCGAGAACGTTCACGGTGCAATTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145100.2-481s1c1
Sequence:CCGGCATGTGTCAGAAAGAAGTGATCTCGAGATCACTTCTTTCTGACACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145100.2-488s1c1
Sequence:CCGGCAGAAAGAAGTGATGGAGCAACTCGAGTTGCTCCATCACTTCTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)