EMAIL THIS PAGE TO A FRIEND

LYPD2

LY6/PLAUR domain containing 2

54 Gene Product Result for
Synonyms: LYPDC2 UNQ430
UniProtKB ID: Q6UXB3, A8K2R6, Q0VD64, Q0VF31
Gene ID:
Mouse(68311) Ly6/Plaur domain containing 2
Rat(300017) Ly6/Plaur domain containing 2
domestic guinea pig(100720719) LY6/PLAUR domain containing 2
naked mole-rat(101703522) LY6/PLAUR domain containing 2
chicken(768929) LY6/PLAUR domain containing 2
cow(790087) LY6/PLAUR domain containing 2
domestic cat(101087452) LY6/PLAUR domain containing 2
dog(609016) LY6/PLAUR domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA028599 Anti-LYPD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_205545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_205545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_205545 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_205545 Rosetta Predictions human pricing
NM_001130545 Rosetta Predictions rat pricing
NM_026671 Rosetta Predictions mouse pricing
XM_128291 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373449 predicted 290
2 SASI_Hs01_00173037 predicted 239
3 SASI_Hs01_00173038 predicted 213
4 SASI_Hs01_00173039 predicted 236
5 SASI_Hs01_00173040 predicted 204
6 SASI_Hs01_00173041 predicted 233
7 SASI_Hs01_00173042 predicted 236
8 SASI_Hs01_00173043 predicted 197
9 SASI_Hs01_00173044 predicted 205
10 SASI_Hs01_00173045 predicted 288
11 SASI_Hs01_00173046 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255629 predicted 292
2 SASI_Rn02_00255630 predicted 268
3 SASI_Rn02_00255631 predicted 200
4 SASI_Rn02_00255632 predicted 206
5 SASI_Rn02_00255633 predicted 309
6 SASI_Rn02_00255634 predicted 194
7 SASI_Rn02_00255635 predicted 275
8 SASI_Rn02_00255636 predicted 222
9 SASI_Rn02_00255637 predicted 307
10 SASI_Rn02_00255638 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330674 predicted 239
2 SASI_Mm02_00330675 predicted 264
3 SASI_Mm02_00330676 predicted 227
4 SASI_Mm02_00330677 predicted 249
5 SASI_Mm02_00330678 predicted 233
6 SASI_Mm02_00330679 predicted 241
7 SASI_Mm02_00330680 predicted 218
8 SASI_Mm02_00330681 predicted 306
9 SASI_Mm02_00330682 predicted 82
10 SASI_Mm02_00330683 predicted 163
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202170 predicted 257
2 SASI_Mm01_00202171 predicted 282
3 SASI_Mm01_00202172 predicted 280
4 SASI_Mm01_00202173 predicted 246
5 SASI_Mm01_00202174 predicted 207
6 SASI_Mm01_00202175 predicted 278
7 SASI_Mm01_00202176 predicted 206
8 SASI_Mm01_00202177 predicted 203
9 SASI_Mm01_00202178 predicted 265
10 SASI_Mm01_00202179 predicted 248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026671
LYPD2 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026671.1-97s21c1
Sequence:CCGGAGTGCTACACCTGTGCGAATCCTCGAGGATTCGCACAGGTGTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026671.1-187s21c1
Sequence:CCGGTCTACTCCCTGGAGATTGTTTCTCGAGAAACAATCTCCAGGGAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026671.1-295s21c1
Sequence:CCGGCAGTGTCCTGCTGCAATTCTGCTCGAGCAGAATTGCAGCAGGACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026671.1-262s21c1
Sequence:CCGGCTTCGGATGTGGATGGCATTGCTCGAGCAATGCCATCCACATCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026671
LYPD2 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026671.1-97s21c1
Sequence:CCGGAGTGCTACACCTGTGCGAATCCTCGAGGATTCGCACAGGTGTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026671.1-187s21c1
Sequence:CCGGTCTACTCCCTGGAGATTGTTTCTCGAGAAACAATCTCCAGGGAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026671.1-295s21c1
Sequence:CCGGCAGTGTCCTGCTGCAATTCTGCTCGAGCAGAATTGCAGCAGGACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026671.1-262s21c1
Sequence:CCGGCTTCGGATGTGGATGGCATTGCTCGAGCAATGCCATCCACATCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026671
LYPD2 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026671.1-97s21c1
Sequence:CCGGAGTGCTACACCTGTGCGAATCCTCGAGGATTCGCACAGGTGTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026671.1-187s21c1
Sequence:CCGGTCTACTCCCTGGAGATTGTTTCTCGAGAAACAATCTCCAGGGAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026671.1-295s21c1
Sequence:CCGGCAGTGTCCTGCTGCAATTCTGCTCGAGCAGAATTGCAGCAGGACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026671.1-262s21c1
Sequence:CCGGCTTCGGATGTGGATGGCATTGCTCGAGCAATGCCATCCACATCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_205545
LYPD2 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-182s21c1
Sequence:CCGGAGTGTCGGACTGTGTCACCATCTCGAGATGGTGACACAGTCCGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-218s21c1
Sequence:CCGGCAACGAAACCATGTGCAAGACCTCGAGGTCTTGCACATGGTTTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-245s21c1
Sequence:CCGGCTACTCCCGGGAGATAGTGTACTCGAGTACACTATCTCCCGGGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-308s21c1
Sequence:CCGGCAAGTGTAAGCCCTCGGATGTCTCGAGACATCCGAGGGCTTACACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-364s21c1
Sequence:CCGGGCAATACTGAGCTGTGCAATGCTCGAGCATTGCACAGCTCAGTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205545.1-227s1c1
Sequence:CCGGCATGTGCAAGACCACACTCTACTCGAGTAGAGTGTGGTCTTGCACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205545.1-365s1c1
Sequence:CCGGCAATACTGAGCTGTGCAATGTCTCGAGACATTGCACAGCTCAGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_205545
LYPD2 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-182s21c1
Sequence:CCGGAGTGTCGGACTGTGTCACCATCTCGAGATGGTGACACAGTCCGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-218s21c1
Sequence:CCGGCAACGAAACCATGTGCAAGACCTCGAGGTCTTGCACATGGTTTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-245s21c1
Sequence:CCGGCTACTCCCGGGAGATAGTGTACTCGAGTACACTATCTCCCGGGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-308s21c1
Sequence:CCGGCAAGTGTAAGCCCTCGGATGTCTCGAGACATCCGAGGGCTTACACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-364s21c1
Sequence:CCGGGCAATACTGAGCTGTGCAATGCTCGAGCATTGCACAGCTCAGTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205545.1-227s1c1
Sequence:CCGGCATGTGCAAGACCACACTCTACTCGAGTAGAGTGTGGTCTTGCACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205545.1-365s1c1
Sequence:CCGGCAATACTGAGCTGTGCAATGTCTCGAGACATTGCACAGCTCAGTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_205545
LYPD2 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-182s21c1
Sequence:CCGGAGTGTCGGACTGTGTCACCATCTCGAGATGGTGACACAGTCCGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-218s21c1
Sequence:CCGGCAACGAAACCATGTGCAAGACCTCGAGGTCTTGCACATGGTTTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-245s21c1
Sequence:CCGGCTACTCCCGGGAGATAGTGTACTCGAGTACACTATCTCCCGGGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-308s21c1
Sequence:CCGGCAAGTGTAAGCCCTCGGATGTCTCGAGACATCCGAGGGCTTACACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_205545.1-364s21c1
Sequence:CCGGGCAATACTGAGCTGTGCAATGCTCGAGCATTGCACAGCTCAGTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205545.1-227s1c1
Sequence:CCGGCATGTGCAAGACCACACTCTACTCGAGTAGAGTGTGGTCTTGCACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_205545.1-365s1c1
Sequence:CCGGCAATACTGAGCTGTGCAATGTCTCGAGACATTGCACAGCTCAGTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)