EMAIL THIS PAGE TO A FRIEND

LYPD3

LY6/PLAUR domain containing 3

77 Gene Product Result for
Synonyms: C4.4A
UniProtKB ID: O95274, Q9UJ74
Gene ID:
Mouse(72434) Ly6/Plaur domain containing 3
Rat(60378) Ly6/Plaur domain containing 3
domestic cat(101081346) LY6/PLAUR domain containing 3
cow(513150) LY6/PLAUR domain containing 3
dog(484471) LY6/PLAUR domain containing 3
naked mole-rat(101697999) LY6/PLAUR domain containing 3
domestic guinea pig(100726093) LY6/PLAUR domain containing 3
sheep(101107889) LY6/PLAUR domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014400 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014400 Rosetta Predictions human pricing
NM_021759 Rosetta Predictions rat pricing
NM_133743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156617 predicted 487
2 SASI_Hs01_00156618 predicted 1158
3 SASI_Hs01_00156619 predicted 431
4 SASI_Hs01_00156620 predicted 415
5 SASI_Hs01_00156621 predicted 638
6 SASI_Hs01_00156622 predicted 849
7 SASI_Hs01_00156623 predicted 845
8 SASI_Hs01_00156624 predicted 578
9 SASI_Hs01_00156625 predicted 1136
10 SASI_Hs01_00156626 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050883 predicted 630
2 SASI_Rn01_00050884 predicted 537
3 SASI_Rn02_00262819 predicted 1259
4 SASI_Rn01_00050885 predicted 451
5 SASI_Rn01_00050886 predicted 1411
6 SASI_Rn01_00050887 predicted 741
7 SASI_Rn01_00050888 predicted 414
8 SASI_Rn01_00050889 predicted 460
9 SASI_Rn01_00050890 predicted 923
10 SASI_Rn01_00050891 predicted 201
11 SASI_Rn01_00050892 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136542 predicted 401
2 SASI_Mm01_00136544 predicted 1153
3 SASI_Mm02_00338731 predicted 762
4 SASI_Mm01_00136546 predicted 563
5 SASI_Mm01_00136547 predicted 356
6 SASI_Mm02_00338732 predicted 319
7 SASI_Mm01_00136548 predicted 1160
8 SASI_Mm01_00136549 predicted 1151
9 SASI_Mm01_00136550 predicted 1043
10 SASI_Mm01_00136551 predicted 819
11 SASI_Mm01_00136543 predicted 1169
12 SASI_Mm01_00136545 predicted 1256
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133743
LYPD3 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133743.1-888s1c1
Sequence:CCGGGATCTCGAAGTCATACAGGAACTCGAGTTCCTGTATGACTTCGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133743.1-698s1c1
Sequence:CCGGCCTTCGCAACAAGACCTATTTCTCGAGAAATAGGTCTTGTTGCGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133743.1-1476s21c1
Sequence:CCGGCTGGCACATTGTGCGGAAATCCTCGAGGATTTCCGCACAATGTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133743.1-230s21c1
Sequence:CCGGAGAGACCATCCACGGGCAATTCTCGAGAATTGCCCGTGGATGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133743.1-699s21c1
Sequence:CCGGCTTCGCAACAAGACCTATTTCCTCGAGGAAATAGGTCTTGTTGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133743.1-166s21c1
Sequence:CCGGACAGGATGAAGACAGTCAAATCTCGAGATTTGACTGTCTTCATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133743.1-977s21c1
Sequence:CCGGCCACCAAGACCGCAGCAATATCTCGAGATATTGCTGCGGTCTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133743
LYPD3 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133743.1-888s1c1
Sequence:CCGGGATCTCGAAGTCATACAGGAACTCGAGTTCCTGTATGACTTCGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133743.1-698s1c1
Sequence:CCGGCCTTCGCAACAAGACCTATTTCTCGAGAAATAGGTCTTGTTGCGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133743.1-1476s21c1
Sequence:CCGGCTGGCACATTGTGCGGAAATCCTCGAGGATTTCCGCACAATGTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133743.1-230s21c1
Sequence:CCGGAGAGACCATCCACGGGCAATTCTCGAGAATTGCCCGTGGATGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133743.1-699s21c1
Sequence:CCGGCTTCGCAACAAGACCTATTTCCTCGAGGAAATAGGTCTTGTTGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133743.1-166s21c1
Sequence:CCGGACAGGATGAAGACAGTCAAATCTCGAGATTTGACTGTCTTCATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133743.1-977s21c1
Sequence:CCGGCCACCAAGACCGCAGCAATATCTCGAGATATTGCTGCGGTCTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133743
LYPD3 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133743.1-888s1c1
Sequence:CCGGGATCTCGAAGTCATACAGGAACTCGAGTTCCTGTATGACTTCGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133743.1-698s1c1
Sequence:CCGGCCTTCGCAACAAGACCTATTTCTCGAGAAATAGGTCTTGTTGCGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133743.1-1476s21c1
Sequence:CCGGCTGGCACATTGTGCGGAAATCCTCGAGGATTTCCGCACAATGTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133743.1-230s21c1
Sequence:CCGGAGAGACCATCCACGGGCAATTCTCGAGAATTGCCCGTGGATGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133743.1-699s21c1
Sequence:CCGGCTTCGCAACAAGACCTATTTCCTCGAGGAAATAGGTCTTGTTGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133743.1-166s21c1
Sequence:CCGGACAGGATGAAGACAGTCAAATCTCGAGATTTGACTGTCTTCATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133743.1-977s21c1
Sequence:CCGGCCACCAAGACCGCAGCAATATCTCGAGATATTGCTGCGGTCTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014400
LYPD3 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162910    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014400.1-1376s1c1
Sequence:CCGGGCTTGTCCTCTTGTGATGTTACTCGAGTAACATCACAAGAGGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014400.1-223s1c1
Sequence:CCGGGAACAAGATGAAGACAGTGAACTCGAGTTCACTGTCTTCATCTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014400.2-1025s21c1
Sequence:CCGGGCAGCAATTCAGGGCAGTATCCTCGAGGATACTGCCCTGAATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014400.2-312s21c1
Sequence:CCGGGGAGACCATCCACGGACAATTCTCGAGAATTGTCCGTGGATGGTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014400.2-781s21c1
Sequence:CCGGCTCCGCAACAAGACCTACTTCCTCGAGGAAGTAGGTCTTGTTGCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014400.2-1298s21c1
Sequence:CCGGGTTTGCGGCTTTGGGAAATAACTCGAGTTATTTCCCAAAGCCGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014400.2-1147s21c1
Sequence:CCGGTGAGCTTCTCCACCTGGAAATCTCGAGATTTCCAGGTGGAGAAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014400
LYPD3 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162910    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014400.1-1376s1c1
Sequence:CCGGGCTTGTCCTCTTGTGATGTTACTCGAGTAACATCACAAGAGGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014400.1-223s1c1
Sequence:CCGGGAACAAGATGAAGACAGTGAACTCGAGTTCACTGTCTTCATCTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014400.2-1025s21c1
Sequence:CCGGGCAGCAATTCAGGGCAGTATCCTCGAGGATACTGCCCTGAATTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014400.2-312s21c1
Sequence:CCGGGGAGACCATCCACGGACAATTCTCGAGAATTGTCCGTGGATGGTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014400.2-781s21c1
Sequence:CCGGCTCCGCAACAAGACCTACTTCCTCGAGGAAGTAGGTCTTGTTGCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014400.2-1298s21c1
Sequence:CCGGGTTTGCGGCTTTGGGAAATAACTCGAGTTATTTCCCAAAGCCGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014400.2-1147s21c1
Sequence:CCGGTGAGCTTCTCCACCTGGAAATCTCGAGATTTCCAGGTGGAGAAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014400
LYPD3 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162910    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014400.1-1376s1c1
Sequence:CCGGGCTTGTCCTCTTGTGATGTTACTCGAGTAACATCACAAGAGGACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014400.1-223s1c1
Sequence:CCGGGAACAAGATGAAGACAGTGAACTCGAGTTCACTGTCTTCATCTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014400.2-1025s21c1
Sequence:CCGGGCAGCAATTCAGGGCAGTATCCTCGAGGATACTGCCCTGAATTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014400.2-312s21c1
Sequence:CCGGGGAGACCATCCACGGACAATTCTCGAGAATTGTCCGTGGATGGTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014400.2-781s21c1
Sequence:CCGGCTCCGCAACAAGACCTACTTCCTCGAGGAAGTAGGTCTTGTTGCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014400.2-1298s21c1
Sequence:CCGGGTTTGCGGCTTTGGGAAATAACTCGAGTTATTTCCCAAAGCCGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014400.2-1147s21c1
Sequence:CCGGTGAGCTTCTCCACCTGGAAATCTCGAGATTTCCAGGTGGAGAAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)