EMAIL THIS PAGE TO A FRIEND

LYPD4

LY6/PLAUR domain containing 4

42 Gene Product Result for
Synonyms: SMR
UniProtKB ID: Q6UWN0, Q8IYW0
Gene ID:
Mouse(232973) Ly6/Plaur domain containing 4
Rat(681194) Ly6/Plaur domain containing 4
sheep(101106616) LY6/PLAUR domain containing 4
domestic guinea pig(100725821) LY6/PLAUR domain containing 4
naked mole-rat(101726283) LY6/PLAUR domain containing 4
dog(100688665) LY6/PLAUR domain containing 4
domestic cat(101082359) LY6/PLAUR domain containing 4
cow(617066) LY6/PLAUR domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173506 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134391 MISSION® esiRNA esiRNA human LYPD4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173506 Rosetta Predictions human pricing
NM_001110295 Rosetta Predictions rat pricing
NM_182785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042092 predicted 1366
2 SASI_Hs01_00042094 predicted 1081
3 SASI_Hs01_00042095 predicted 1077
4 SASI_Hs01_00042096 predicted 1308
5 SASI_Hs01_00042097 predicted 1166
6 SASI_Hs01_00042098 predicted 1335
7 SASI_Hs01_00042099 predicted 1250
8 SASI_Hs01_00042100 predicted 1096
9 SASI_Hs01_00042101 predicted 1481
10 SASI_Hs02_00368276 predicted 1082
11 SASI_Hs01_00042093 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251112 predicted 801
2 SASI_Rn02_00251113 predicted 459
3 SASI_Rn02_00251114 predicted 420
4 SASI_Rn02_00251115 predicted 505
5 SASI_Rn02_00251116 predicted 654
6 SASI_Rn02_00251117 predicted 926
7 SASI_Rn02_00251118 predicted 646
8 SASI_Rn02_00251119 predicted 861
9 SASI_Rn02_00251120 predicted 808
10 SASI_Rn02_00251121 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174088 predicted 322
2 SASI_Mm01_00174089 predicted 344
3 SASI_Mm01_00174090 predicted 732
4 SASI_Mm01_00174091 predicted 612
5 SASI_Mm01_00174092 predicted 495
6 SASI_Mm01_00174093 predicted 775
7 SASI_Mm01_00174094 predicted 627
8 SASI_Mm01_00174095 predicted 327
9 SASI_Mm01_00174096 predicted 433
10 SASI_Mm01_00174097 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173506
LYPD4 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173506.4-1369s21c1
Sequence:CCGGGCCAGCACTCCTAAGTCTATCCTCGAGGATAGACTTAGGAGTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1491s1c1
Sequence:CCGGCGTGTTACAGTTCCACCTTAACTCGAGTTAAGGTGGAACTGTAACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1315s1c1
Sequence:CCGGCCGGTCTTATCTCTGCAACAACTCGAGTTGTTGCAGAGATAAGACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173506.4-1434s21c1
Sequence:CCGGGAAGGATTGCCTCCCAAATTTCTCGAGAAATTTGGGAGGCAATCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1253s1c1
Sequence:CCGGGCGCAAATCTCCTACCTTGTTCTCGAGAACAAGGTAGGAGATTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1559s1c1
Sequence:CCGGGCTCGTGAACATAACCAGCTTCTCGAGAAGCTGGTTATGTTCACGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1123s1c1
Sequence:CCGGGTGGCTTCTGATGAGGAACATCTCGAGATGTTCCTCATCAGAAGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173506.4-1228s21c1
Sequence:CCGGTGCAGCTCGTCTTCGTCTTACCTCGAGGTAAGACGAAGACGAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1374s1c1
Sequence:CCGGGCACTCCTAAGTCTATCACATCTCGAGATGTGATAGACTTAGGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1132s1c1
Sequence:CCGGGATGAGGAACATGGTGTGTAACTCGAGTTACACACCATGTTCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173506
LYPD4 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173506.4-1369s21c1
Sequence:CCGGGCCAGCACTCCTAAGTCTATCCTCGAGGATAGACTTAGGAGTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1491s1c1
Sequence:CCGGCGTGTTACAGTTCCACCTTAACTCGAGTTAAGGTGGAACTGTAACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1315s1c1
Sequence:CCGGCCGGTCTTATCTCTGCAACAACTCGAGTTGTTGCAGAGATAAGACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173506.4-1434s21c1
Sequence:CCGGGAAGGATTGCCTCCCAAATTTCTCGAGAAATTTGGGAGGCAATCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1253s1c1
Sequence:CCGGGCGCAAATCTCCTACCTTGTTCTCGAGAACAAGGTAGGAGATTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1559s1c1
Sequence:CCGGGCTCGTGAACATAACCAGCTTCTCGAGAAGCTGGTTATGTTCACGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1123s1c1
Sequence:CCGGGTGGCTTCTGATGAGGAACATCTCGAGATGTTCCTCATCAGAAGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173506.4-1228s21c1
Sequence:CCGGTGCAGCTCGTCTTCGTCTTACCTCGAGGTAAGACGAAGACGAGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1374s1c1
Sequence:CCGGGCACTCCTAAGTCTATCACATCTCGAGATGTGATAGACTTAGGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1132s1c1
Sequence:CCGGGATGAGGAACATGGTGTGTAACTCGAGTTACACACCATGTTCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173506
LYPD4 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173506.4-1369s21c1
Sequence:CCGGGCCAGCACTCCTAAGTCTATCCTCGAGGATAGACTTAGGAGTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1491s1c1
Sequence:CCGGCGTGTTACAGTTCCACCTTAACTCGAGTTAAGGTGGAACTGTAACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1315s1c1
Sequence:CCGGCCGGTCTTATCTCTGCAACAACTCGAGTTGTTGCAGAGATAAGACCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173506.4-1434s21c1
Sequence:CCGGGAAGGATTGCCTCCCAAATTTCTCGAGAAATTTGGGAGGCAATCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1253s1c1
Sequence:CCGGGCGCAAATCTCCTACCTTGTTCTCGAGAACAAGGTAGGAGATTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1559s1c1
Sequence:CCGGGCTCGTGAACATAACCAGCTTCTCGAGAAGCTGGTTATGTTCACGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1123s1c1
Sequence:CCGGGTGGCTTCTGATGAGGAACATCTCGAGATGTTCCTCATCAGAAGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173506.4-1228s21c1
Sequence:CCGGTGCAGCTCGTCTTCGTCTTACCTCGAGGTAAGACGAAGACGAGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1374s1c1
Sequence:CCGGGCACTCCTAAGTCTATCACATCTCGAGATGTGATAGACTTAGGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173506.3-1132s1c1
Sequence:CCGGGATGAGGAACATGGTGTGTAACTCGAGTTACACACCATGTTCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182785
LYPD4 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-334s1c1
Sequence:CCGGCCATCTCTTTACTGCCTTGTACTCGAGTACAAGGCAGTAAAGAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-918s1c1
Sequence:CCGGGAGGTCATCAATGTCCTAGATCTCGAGATCTAGGACATTGATGACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-401s1c1
Sequence:CCGGCGTGTCCTTGCATAACTGGAACTCGAGTTCCAGTTATGCAAGGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-776s1c1
Sequence:CCGGCTTTGCTGCTTCCTCATGTTACTCGAGTAACATGAGGAAGCAGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-790s1c1
Sequence:CCGGCATGTTACAGTTCCACCTTAACTCGAGTTAAGGTGGAACTGTAACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182785
LYPD4 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-334s1c1
Sequence:CCGGCCATCTCTTTACTGCCTTGTACTCGAGTACAAGGCAGTAAAGAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-918s1c1
Sequence:CCGGGAGGTCATCAATGTCCTAGATCTCGAGATCTAGGACATTGATGACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-401s1c1
Sequence:CCGGCGTGTCCTTGCATAACTGGAACTCGAGTTCCAGTTATGCAAGGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-776s1c1
Sequence:CCGGCTTTGCTGCTTCCTCATGTTACTCGAGTAACATGAGGAAGCAGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-790s1c1
Sequence:CCGGCATGTTACAGTTCCACCTTAACTCGAGTTAAGGTGGAACTGTAACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182785
LYPD4 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-334s1c1
Sequence:CCGGCCATCTCTTTACTGCCTTGTACTCGAGTACAAGGCAGTAAAGAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-918s1c1
Sequence:CCGGGAGGTCATCAATGTCCTAGATCTCGAGATCTAGGACATTGATGACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-401s1c1
Sequence:CCGGCGTGTCCTTGCATAACTGGAACTCGAGTTCCAGTTATGCAAGGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-776s1c1
Sequence:CCGGCTTTGCTGCTTCCTCATGTTACTCGAGTAACATGAGGAAGCAGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182785.1-790s1c1
Sequence:CCGGCATGTTACAGTTCCACCTTAACTCGAGTTAAGGTGGAACTGTAACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)