EMAIL THIS PAGE TO A FRIEND

LYPD5

LY6/PLAUR domain containing 5

115 Gene Product Result for
Synonyms: PRO4356
UniProtKB ID: Q6UWN5, Q6PEX9, Q96DR2
Gene ID:
Mouse(76942) Ly6/Plaur domain containing 5
Rat(502308) Ly6/Plaur domain containing 5
cow(789905) LY6/PLAUR domain containing 5
domestic cat(101101017) LY6/PLAUR domain containing 5
naked mole-rat(101708561) LY6/PLAUR domain containing 5
domestic guinea pig(100715490) LY6/PLAUR domain containing 5
sheep(101108855) LY6/PLAUR domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182573 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031749 Rosetta Predictions human pricing
NM_182573 Rosetta Predictions human pricing
XM_001076504 Rosetta Predictions rat pricing
XM_577772 Rosetta Predictions rat pricing
NM_029806 Rosetta Predictions mouse pricing
XM_133245 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144387 predicted 714
2 SASI_Hs01_00144388 predicted 578
3 SASI_Hs01_00144389 predicted 587
4 SASI_Hs01_00144391 predicted 580
5 SASI_Hs02_00307810 predicted 609
6 SASI_Hs02_00307811 predicted 866
7 SASI_Hs01_00144393 predicted 571
8 SASI_Hs02_00307812 predicted 601
9 SASI_Hs01_00144395 predicted 931
10 SASI_Hs01_00144396 predicted 987
11 SASI_Hs01_00144390 predicted 207
12 SASI_Hs01_00144392 predicted 240
13 SASI_Hs01_00144394 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017304 predicted 685
2 SASI_Hs01_00017305 predicted 554
3 SASI_Hs01_00017307 predicted 561
4 SASI_Hs01_00017306 predicted 556
5 SASI_Hs01_00017308 predicted 581
6 SASI_Hs01_00017310 predicted 834
7 SASI_Hs02_00370702 predicted 547
8 SASI_Hs01_00017311 predicted 574
9 SASI_Hs01_00017312 predicted 906
10 SASI_Hs01_00017313 predicted 964
11 SASI_Hs01_00017309 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353497 predicted 491
2 SASI_Rn02_00353498 predicted 412
3 SASI_Rn02_00353499 predicted 372
4 SASI_Rn02_00353500 predicted 296
5 SASI_Rn02_00353501 predicted 523
6 SASI_Rn02_00353502 predicted 364
7 SASI_Rn02_00353503 predicted 261
8 SASI_Rn02_00353504 predicted 298
9 SASI_Rn02_00353505 predicted 493
10 SASI_Rn02_00353506 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407047 predicted 946
2 SASI_Rn02_00407048 predicted 518
3 SASI_Rn02_00407049 predicted 220
4 SASI_Rn02_00407050 predicted 938
5 SASI_Rn02_00407051 predicted 610
6 SASI_Rn02_00407052 predicted 725
7 SASI_Rn02_00407053 predicted 433
8 SASI_Rn02_00407054 predicted 404
9 SASI_Rn02_00407055 predicted 286
10 SASI_Rn02_00407056 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335973 predicted 307
2 SASI_Mm02_00335974 predicted 513
3 SASI_Mm02_00335975 predicted 606
4 SASI_Mm02_00335976 predicted 394
5 SASI_Mm02_00335977 predicted 210
6 SASI_Mm02_00335978 predicted 539
7 SASI_Mm02_00335979 predicted 666
8 SASI_Mm02_00335980 predicted 528
9 SASI_Mm02_00335981 predicted 512
10 SASI_Mm02_00335982 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133245 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285257 predicted 1053
2 SASI_Mm01_00285258 predicted 861
3 SASI_Mm01_00285259 predicted 1004
4 SASI_Mm01_00285260 predicted 1014
5 SASI_Mm01_00285261 predicted 989
6 SASI_Mm01_00285262 predicted 1046
7 SASI_Mm01_00285263 predicted 983
8 SASI_Mm01_00285264 predicted 1013
9 SASI_Mm01_00285265 predicted 922
10 SASI_Mm01_00285266 predicted 1117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029806
LYPD5 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-103s21c1
Sequence:CCGGAGCTACGAGCACACCTACTTCCTCGAGGAAGTAGGTGTGCTCGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-521s21c1
Sequence:CCGGGGATGAACATTGGCAACTTCTCTCGAGAGAAGTTGCCAATGTTCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-612s21c1
Sequence:CCGGATCCATCGACCTGCAGGGTTACTCGAGTAACCCTGCAGGTCGATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-193s21c1
Sequence:CCGGTTGTCGCTGGATACCGGTTACCTCGAGGTAACCGGTATCCAGCGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-221s21c1
Sequence:CCGGTGGTGACAATGGTCCGGAAAGCTCGAGCTTTCCGGACCATTGTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029806
LYPD5 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-103s21c1
Sequence:CCGGAGCTACGAGCACACCTACTTCCTCGAGGAAGTAGGTGTGCTCGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-521s21c1
Sequence:CCGGGGATGAACATTGGCAACTTCTCTCGAGAGAAGTTGCCAATGTTCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-612s21c1
Sequence:CCGGATCCATCGACCTGCAGGGTTACTCGAGTAACCCTGCAGGTCGATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-193s21c1
Sequence:CCGGTTGTCGCTGGATACCGGTTACCTCGAGGTAACCGGTATCCAGCGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-221s21c1
Sequence:CCGGTGGTGACAATGGTCCGGAAAGCTCGAGCTTTCCGGACCATTGTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029806
LYPD5 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-103s21c1
Sequence:CCGGAGCTACGAGCACACCTACTTCCTCGAGGAAGTAGGTGTGCTCGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-521s21c1
Sequence:CCGGGGATGAACATTGGCAACTTCTCTCGAGAGAAGTTGCCAATGTTCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-612s21c1
Sequence:CCGGATCCATCGACCTGCAGGGTTACTCGAGTAACCCTGCAGGTCGATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-193s21c1
Sequence:CCGGTTGTCGCTGGATACCGGTTACCTCGAGGTAACCGGTATCCAGCGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029806.1-221s21c1
Sequence:CCGGTGGTGACAATGGTCCGGAAAGCTCGAGCTTTCCGGACCATTGTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182573
LYPD5 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182573.1-537s1c1
Sequence:CCGGGAATGACAGTTGGCAATTTCTCTCGAGAGAAATTGCCAACTGTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182573.2-355s21c1
Sequence:CCGGGCGGCTGCACAACTGACAAATCTCGAGATTTGTCAGTTGTGCAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182573.2-689s21c1
Sequence:CCGGCTGCAACAGGAAATCCATGACCTCGAGGTCATGGATTTCCTGTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182573.1-534s1c1
Sequence:CCGGGCAGAATGACAGTTGGCAATTCTCGAGAATTGCCAACTGTCATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182573.2-581s21c1
Sequence:CCGGAGTCCCTGTGTACATCAGAACCTCGAGGTTCTGATGTACACAGGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182573.1-535s1c1
Sequence:CCGGCAGAATGACAGTTGGCAATTTCTCGAGAAATTGCCAACTGTCATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182573.1-1601s1c1
Sequence:CCGGGCTACTTGTCATAAGCCCTAACTCGAGTTAGGGCTTATGACAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182573
LYPD5 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182573.1-537s1c1
Sequence:CCGGGAATGACAGTTGGCAATTTCTCTCGAGAGAAATTGCCAACTGTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000453477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182573.2-355s21c1
Sequence:CCGGGCGGCTGCACAACTGACAAATCTCGAGATTTGTCAGTTGTGCAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182573.2-689s21c1
Sequence:CCGGCTGCAACAGGAAATCCATGACCTCGAGGTCATGGATTTCCTGTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182573.1-534s1c1
Sequence:CCGGGCAGAATGACAGTTGGCAATTCTCGAGAATTGCCAACTGTCATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182573.2-581s21c1
Sequence:CCGGAGTCCCTGTGTACATCAGAACCTCGAGGTTCTGATGTACACAGGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182573.1-535s1c1
Sequence:CCGGCAGAATGACAGTTGGCAATTTCTCGAGAAATTGCCAACTGTCATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182573.1-1601s1c1
Sequence:CCGGGCTACTTGTCATAAGCCCTAACTCGAGTTAGGGCTTATGACAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182573
LYPD5 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182573.1-537s1c1
Sequence:CCGGGAATGACAGTTGGCAATTTCTCTCGAGAGAAATTGCCAACTGTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000453477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182573.2-355s21c1
Sequence:CCGGGCGGCTGCACAACTGACAAATCTCGAGATTTGTCAGTTGTGCAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182573.2-689s21c1
Sequence:CCGGCTGCAACAGGAAATCCATGACCTCGAGGTCATGGATTTCCTGTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182573.1-534s1c1
Sequence:CCGGGCAGAATGACAGTTGGCAATTCTCGAGAATTGCCAACTGTCATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182573.2-581s21c1
Sequence:CCGGAGTCCCTGTGTACATCAGAACCTCGAGGTTCTGATGTACACAGGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182573.1-535s1c1
Sequence:CCGGCAGAATGACAGTTGGCAATTTCTCGAGAAATTGCCAACTGTCATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182573.1-1601s1c1
Sequence:CCGGGCTACTTGTCATAAGCCCTAACTCGAGTTAGGGCTTATGACAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)