EMAIL THIS PAGE TO A FRIEND

LYPD6

LY6/PLAUR domain containing 6

227 Gene Product Result for
UniProtKB ID: Q86Y78, B3KWC0, Q4G121, Q53TR3, Q659B1
Gene ID:
Human(130574) Summary: Members of the LY6 protein family (see SLURP1; MIM 606119), such as LYPD6, have at least one 80-amino acid LU domain that contains 10 conserved cysteines with a defined disulfide-bonding pattern (Zhang et al., 2010 [PubMed 19653121]
Mouse(320343) LY6/PLAUR domain containing 6
Rat(679564) LY6/PLAUR domain containing 6
sheep(101121152) LY6/PLAUR domain containing 6
domestic guinea pig(100725882) LY6/PLAUR domain containing 6
naked mole-rat(101714510) LY6/PLAUR domain containing 6
Zebrafish(447932) LY6/PLAUR domain containing 6
cow(100337491) LY6/PLAUR domain containing 6
domestic cat(101099391) LY6/PLAUR domain containing 6
chicken(771649) LY6/PLAUR domain containing 6
dog(608509) LY6/PLAUR domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194317 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194317 Rosetta Predictions human pricing
XM_001053512 Rosetta Predictions rat pricing
NM_177139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123619 predicted 844
2 SASI_Hs01_00123620 predicted 353
3 SASI_Hs01_00123621 predicted 928
4 SASI_Hs02_00371455 predicted 694
5 SASI_Hs01_00123622 predicted 962
6 SASI_Hs01_00123623 predicted 329
7 SASI_Hs01_00123624 predicted 770
8 SASI_Hs01_00123625 predicted 822
9 SASI_Hs01_00123627 predicted 312
10 SASI_Hs01_00123628 predicted 884
11 SASI_Hs01_00123626 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00272566 predicted 249
2 SASI_Rn02_00272567 predicted 255
3 SASI_Rn02_00272568 predicted 206
4 SASI_Rn02_00272569 predicted 216
5 SASI_Rn02_00272570 predicted 247
6 SASI_Rn02_00272571 predicted 243
7 SASI_Rn02_00272572 predicted 254
8 SASI_Rn02_00272573 predicted 213
9 SASI_Rn02_00272574 predicted 209
10 SASI_Rn02_00272575 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347135 predicted 385
2 SASI_Mm01_00163695 predicted 603
3 SASI_Mm01_00163697 predicted 407
4 SASI_Mm01_00163699 predicted 935
5 SASI_Mm01_00163700 predicted 750
6 SASI_Mm02_00347136 predicted 997
7 SASI_Mm01_00163701 predicted 1031
8 SASI_Mm02_00347137 predicted 1023
9 SASI_Mm01_00163703 predicted 896
10 SASI_Mm01_00163704 predicted 773
11 SASI_Mm01_00163696 predicted 1048
12 SASI_Mm01_00163698 predicted 659
13 SASI_Mm01_00163702 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194317
LYPD6 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194317.2-615s21c1
Sequence:CCGGTGCCACGACGTCACCTATAAACTCGAGTTTATAGGTGACGTCGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-537s1c1
Sequence:CCGGCTGCTACACTCAGCACACAATCTCGAGATTGTGTGCTGAGTGTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-547s1c1
Sequence:CCGGCAGCACACAATGGAAGTCACACTCGAGTGTGACTTCCATTGTGTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-730s1c1
Sequence:CCGGGCCACGACGTCACCTATAAATCTCGAGATTTATAGGTGACGTCGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194317.1-783s1c1
Sequence:CCGGGATAGTGTCCTGCTTGTGGTTCTCGAGAACCACAAGCAGGACACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194317.2-1172s21c1
Sequence:CCGGCCAAACTGAATGGACTATTTCCTCGAGGAAATAGTCCATTCAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-704s1c1
Sequence:CCGGCCCGAAATGAAACTGATGCCACTCGAGTGGCATCAGTTTCATTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194317.1-766s1c1
Sequence:CCGGCCACGCTGTATGTCAGTGATACTCGAGTATCACTGACATACAGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194317.2-318s21c1
Sequence:CCGGACCATATCCTGGTGGATTTAACTCGAGTTAAATCCACCAGGATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-569s1c1
Sequence:CCGGGAAACAGTATCTCAGTCACCACTCGAGTGGTGACTGAGATACTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194317
LYPD6 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194317.2-615s21c1
Sequence:CCGGTGCCACGACGTCACCTATAAACTCGAGTTTATAGGTGACGTCGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-537s1c1
Sequence:CCGGCTGCTACACTCAGCACACAATCTCGAGATTGTGTGCTGAGTGTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-547s1c1
Sequence:CCGGCAGCACACAATGGAAGTCACACTCGAGTGTGACTTCCATTGTGTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-730s1c1
Sequence:CCGGGCCACGACGTCACCTATAAATCTCGAGATTTATAGGTGACGTCGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194317.1-783s1c1
Sequence:CCGGGATAGTGTCCTGCTTGTGGTTCTCGAGAACCACAAGCAGGACACTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194317.2-1172s21c1
Sequence:CCGGCCAAACTGAATGGACTATTTCCTCGAGGAAATAGTCCATTCAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-704s1c1
Sequence:CCGGCCCGAAATGAAACTGATGCCACTCGAGTGGCATCAGTTTCATTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194317.1-766s1c1
Sequence:CCGGCCACGCTGTATGTCAGTGATACTCGAGTATCACTGACATACAGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194317.2-318s21c1
Sequence:CCGGACCATATCCTGGTGGATTTAACTCGAGTTAAATCCACCAGGATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-569s1c1
Sequence:CCGGGAAACAGTATCTCAGTCACCACTCGAGTGGTGACTGAGATACTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194317
LYPD6 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194317.2-615s21c1
Sequence:CCGGTGCCACGACGTCACCTATAAACTCGAGTTTATAGGTGACGTCGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-537s1c1
Sequence:CCGGCTGCTACACTCAGCACACAATCTCGAGATTGTGTGCTGAGTGTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-547s1c1
Sequence:CCGGCAGCACACAATGGAAGTCACACTCGAGTGTGACTTCCATTGTGTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-730s1c1
Sequence:CCGGGCCACGACGTCACCTATAAATCTCGAGATTTATAGGTGACGTCGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172720    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194317.1-783s1c1
Sequence:CCGGGATAGTGTCCTGCTTGTGGTTCTCGAGAACCACAAGCAGGACACTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372889    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194317.2-1172s21c1
Sequence:CCGGCCAAACTGAATGGACTATTTCCTCGAGGAAATAGTCCATTCAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-704s1c1
Sequence:CCGGCCCGAAATGAAACTGATGCCACTCGAGTGGCATCAGTTTCATTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194317.1-766s1c1
Sequence:CCGGCCACGCTGTATGTCAGTGATACTCGAGTATCACTGACATACAGCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194317.2-318s21c1
Sequence:CCGGACCATATCCTGGTGGATTTAACTCGAGTTAAATCCACCAGGATATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194317.1-569s1c1
Sequence:CCGGGAAACAGTATCTCAGTCACCACTCGAGTGGTGACTGAGATACTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177139
LYPD6 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177139.3-743s21c1
Sequence:CCGGGTGGCTGGGACTCACCTTATACTCGAGTATAAGGTGAGTCCCAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177139.3-371s21c1
Sequence:CCGGTCCGTATCCTGGTGGGTTTAACTCGAGTTAAACCCACCAGGATACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177139.2-452s1c1
Sequence:CCGGGACATAATCTACCTCCACCCTCTCGAGAGGGTGGAGGTAGATTATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177139.2-822s1c1
Sequence:CCGGGTGTTTCAGTGATCGTGTCCTCTCGAGAGGACACGATCACTGAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177139.3-667s21c1
Sequence:CCGGTTGCTACCACATCACCTATAACTCGAGTTATAGGTGATGTGGTAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177139.3-884s21c1
Sequence:CCGGTCATCGCAGCCACCCATTAATCTCGAGATTAATGGGTGGCTGCGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177139.2-577s1c1
Sequence:CCGGCACCAGATACTGCTACACTCACTCGAGTGAGTGTAGCAGTATCTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177139.3-612s21c1
Sequence:CCGGTGTGAAGGAAATATCTGTAATCTCGAGATTACAGATATTTCCTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177139
LYPD6 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177139.3-743s21c1
Sequence:CCGGGTGGCTGGGACTCACCTTATACTCGAGTATAAGGTGAGTCCCAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177139.3-371s21c1
Sequence:CCGGTCCGTATCCTGGTGGGTTTAACTCGAGTTAAACCCACCAGGATACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177139.2-452s1c1
Sequence:CCGGGACATAATCTACCTCCACCCTCTCGAGAGGGTGGAGGTAGATTATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177139.2-822s1c1
Sequence:CCGGGTGTTTCAGTGATCGTGTCCTCTCGAGAGGACACGATCACTGAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177139.3-667s21c1
Sequence:CCGGTTGCTACCACATCACCTATAACTCGAGTTATAGGTGATGTGGTAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177139.3-884s21c1
Sequence:CCGGTCATCGCAGCCACCCATTAATCTCGAGATTAATGGGTGGCTGCGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177139.2-577s1c1
Sequence:CCGGCACCAGATACTGCTACACTCACTCGAGTGAGTGTAGCAGTATCTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177139.3-612s21c1
Sequence:CCGGTGTGAAGGAAATATCTGTAATCTCGAGATTACAGATATTTCCTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177139
LYPD6 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177139.3-743s21c1
Sequence:CCGGGTGGCTGGGACTCACCTTATACTCGAGTATAAGGTGAGTCCCAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177139.3-371s21c1
Sequence:CCGGTCCGTATCCTGGTGGGTTTAACTCGAGTTAAACCCACCAGGATACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177139.2-452s1c1
Sequence:CCGGGACATAATCTACCTCCACCCTCTCGAGAGGGTGGAGGTAGATTATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177139.2-822s1c1
Sequence:CCGGGTGTTTCAGTGATCGTGTCCTCTCGAGAGGACACGATCACTGAAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177139.3-667s21c1
Sequence:CCGGTTGCTACCACATCACCTATAACTCGAGTTATAGGTGATGTGGTAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177139.3-884s21c1
Sequence:CCGGTCATCGCAGCCACCCATTAATCTCGAGATTAATGGGTGGCTGCGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177139.2-577s1c1
Sequence:CCGGCACCAGATACTGCTACACTCACTCGAGTGAGTGTAGCAGTATCTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177139.3-612s21c1
Sequence:CCGGTGTGAAGGAAATATCTGTAATCTCGAGATTACAGATATTTCCTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)