EMAIL THIS PAGE TO A FRIEND

LYPD6B

LY6/PLAUR domain containing 6B

57 Gene Product Result for
Synonyms: CT116 LYPD7
UniProtKB ID: Q8NI32, D3DP90, Q53TK0, Q7Z747, Q8IXK7
Gene ID:
Mouse(71897) LY6/PLAUR domain containing 6B
Rat(362133) LY6/PLAUR domain containing 6B
Zebrafish(553752) LY6/PLAUR domain containing 6B
chicken(424310) LY6/PLAUR domain containing 6B
domestic cat(101084896) LY6/PLAUR domain containing 6B
naked mole-rat(101711910) LY6/PLAUR domain containing 6B
domestic guinea pig(100726436) LY6/PLAUR domain containing 6B
sheep(101113397) LY6/PLAUR domain containing 6B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027990 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027990 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027990 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177964 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076221 MISSION® esiRNA esiRNA human LYPD6B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177964 Rosetta Predictions human pricing
NM_001134580 Rosetta Predictions rat pricing
XM_342433 Rosetta Predictions rat pricing
NM_027990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369436 predicted 702
2 SASI_Hs01_00095986 predicted 733
3 SASI_Hs01_00095987 predicted 914
4 SASI_Hs02_00369437 predicted 539
5 SASI_Hs01_00095988 predicted 457
6 SASI_Hs01_00095989 predicted 748
7 SASI_Hs01_00095990 predicted 447
8 SASI_Hs01_00095991 predicted 1105
9 SASI_Hs01_00095992 predicted 464
10 SASI_Hs02_00369438 predicted 595
11 SASI_Hs01_00095984 predicted 904
12 SASI_Hs01_00095985 predicted 647
13 SASI_Hs01_00095993 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134580 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257289 predicted 774
2 SASI_Rn02_00257290 predicted 517
3 SASI_Rn02_00257291 predicted 878
4 SASI_Rn02_00257292 predicted 737
5 SASI_Rn02_00257293 predicted 1077
6 SASI_Rn02_00257294 predicted 752
7 SASI_Rn02_00257295 predicted 1465
8 SASI_Rn02_00257296 predicted 1226
9 SASI_Rn02_00257297 predicted 1150
10 SASI_Rn02_00257298 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342433 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147832 predicted 366
2 SASI_Rn01_00147833 predicted 299
3 SASI_Rn01_00147834 predicted 361
4 SASI_Rn01_00147835 predicted 318
5 SASI_Rn01_00147836 predicted 327
6 SASI_Rn01_00147837 predicted 236
7 SASI_Rn01_00147838 predicted 313
8 SASI_Rn01_00147839 predicted 218
9 SASI_Rn01_00147840 predicted 327
10 SASI_Rn01_00147841 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102665 predicted 778
2 SASI_Mm01_00102666 predicted 772
3 SASI_Mm01_00102667 predicted 1134
4 SASI_Mm01_00102669 predicted 511
5 SASI_Mm01_00102670 predicted 911
6 SASI_Mm01_00102672 predicted 731
7 SASI_Mm01_00102673 predicted 873
8 SASI_Mm01_00102674 predicted 750
9 SASI_Mm02_00333056 predicted 631
10 SASI_Mm02_00333057 predicted 1077
11 SASI_Mm01_00102668 predicted 1166
12 SASI_Mm01_00102671 predicted 584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027990
LYPD6B MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 6B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027990.1-1779s1c1
Sequence:CCGGGCACAGACATACATGCAGGTACTCGAGTACCTGCATGTATGTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027990.1-786s1c1
Sequence:CCGGCACGAAGAAGTGTGCCTCTAACTCGAGTTAGAGGCACACTTCTTCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027990.1-909s1c1
Sequence:CCGGCAACCACACAAATGCAGTCTTCTCGAGAAGACTGCATTTGTGTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027990.1-723s1c1
Sequence:CCGGGCAGGACACACAGTATTGTTTCTCGAGAAACAATACTGTGTGTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027990.1-877s1c1
Sequence:CCGGGAAGGAATGATCTGCAACGTACTCGAGTACGTTGCAGATCATTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027990
LYPD6B MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 6B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027990.1-1779s1c1
Sequence:CCGGGCACAGACATACATGCAGGTACTCGAGTACCTGCATGTATGTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027990.1-786s1c1
Sequence:CCGGCACGAAGAAGTGTGCCTCTAACTCGAGTTAGAGGCACACTTCTTCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027990.1-909s1c1
Sequence:CCGGCAACCACACAAATGCAGTCTTCTCGAGAAGACTGCATTTGTGTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027990.1-723s1c1
Sequence:CCGGGCAGGACACACAGTATTGTTTCTCGAGAAACAATACTGTGTGTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027990.1-877s1c1
Sequence:CCGGGAAGGAATGATCTGCAACGTACTCGAGTACGTTGCAGATCATTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027990
LYPD6B MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 6B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196149    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027990.1-1779s1c1
Sequence:CCGGGCACAGACATACATGCAGGTACTCGAGTACCTGCATGTATGTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027990.1-786s1c1
Sequence:CCGGCACGAAGAAGTGTGCCTCTAACTCGAGTTAGAGGCACACTTCTTCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027990.1-909s1c1
Sequence:CCGGCAACCACACAAATGCAGTCTTCTCGAGAAGACTGCATTTGTGTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027990.1-723s1c1
Sequence:CCGGGCAGGACACACAGTATTGTTTCTCGAGAAACAATACTGTGTGTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027990.1-877s1c1
Sequence:CCGGGAAGGAATGATCTGCAACGTACTCGAGTACGTTGCAGATCATTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177964
LYPD6B MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 6B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177964.3-998s1c1
Sequence:CCGGCTGGGTCTTTGTGCTTCCATTCTCGAGAATGGAAGCACAAAGACCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164602    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177964.3-1157s1c1
Sequence:CCGGCCAGTGGTTTGCTTGGATAAACTCGAGTTTATCCAAGCAAACCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177964.3-555s1c1
Sequence:CCGGCAGATCGTTATCTTCTCAGAACTCGAGTTCTGAGAAGATAACGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177964.3-708s1c1
Sequence:CCGGGAAGACAAATGGTGTCCACAACTCGAGTTGTGGACACCATTTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177964.3-874s1c1
Sequence:CCGGGCTGTGAAGGAATGATCTGCACTCGAGTGCAGATCATTCCTTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166404    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177964.3-1225s1c1
Sequence:CCGGCCTGAGAAGATGGTCTGACTTCTCGAGAAGTCAGACCATCTTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177964.3-525s21c1
Sequence:CCGGCTCTGTCACGCTCTCGCTATACTCGAGTATAGCGAGAGCGTGACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177964.3-1094s21c1
Sequence:CCGGACTTTGGAGTGAAGATCAATCCTCGAGGATTGATCTTCACTCCAAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177964
LYPD6B MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 6B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177964.3-998s1c1
Sequence:CCGGCTGGGTCTTTGTGCTTCCATTCTCGAGAATGGAAGCACAAAGACCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164602    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177964.3-1157s1c1
Sequence:CCGGCCAGTGGTTTGCTTGGATAAACTCGAGTTTATCCAAGCAAACCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177964.3-555s1c1
Sequence:CCGGCAGATCGTTATCTTCTCAGAACTCGAGTTCTGAGAAGATAACGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177964.3-708s1c1
Sequence:CCGGGAAGACAAATGGTGTCCACAACTCGAGTTGTGGACACCATTTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177964.3-874s1c1
Sequence:CCGGGCTGTGAAGGAATGATCTGCACTCGAGTGCAGATCATTCCTTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166404    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177964.3-1225s1c1
Sequence:CCGGCCTGAGAAGATGGTCTGACTTCTCGAGAAGTCAGACCATCTTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177964.3-525s21c1
Sequence:CCGGCTCTGTCACGCTCTCGCTATACTCGAGTATAGCGAGAGCGTGACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177964.3-1094s21c1
Sequence:CCGGACTTTGGAGTGAAGATCAATCCTCGAGGATTGATCTTCACTCCAAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177964
LYPD6B MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 6B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177964.3-998s1c1
Sequence:CCGGCTGGGTCTTTGTGCTTCCATTCTCGAGAATGGAAGCACAAAGACCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164602    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177964.3-1157s1c1
Sequence:CCGGCCAGTGGTTTGCTTGGATAAACTCGAGTTTATCCAAGCAAACCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177964.3-555s1c1
Sequence:CCGGCAGATCGTTATCTTCTCAGAACTCGAGTTCTGAGAAGATAACGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177964.3-708s1c1
Sequence:CCGGGAAGACAAATGGTGTCCACAACTCGAGTTGTGGACACCATTTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177964.3-874s1c1
Sequence:CCGGGCTGTGAAGGAATGATCTGCACTCGAGTGCAGATCATTCCTTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166404    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177964.3-1225s1c1
Sequence:CCGGCCTGAGAAGATGGTCTGACTTCTCGAGAAGTCAGACCATCTTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177964.3-525s21c1
Sequence:CCGGCTCTGTCACGCTCTCGCTATACTCGAGTATAGCGAGAGCGTGACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177964.3-1094s21c1
Sequence:CCGGACTTTGGAGTGAAGATCAATCCTCGAGGATTGATCTTCACTCCAAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)