EMAIL THIS PAGE TO A FRIEND

LYPD8

LY6/PLAUR domain containing 8

59 Gene Product Result for
UniProtKB ID: Q6UX82
Gene ID:
Mouse(70163) LY6/PLAUR domain containing 8
Rat(691259) LY6/PLAUR domain containing 8
sheep(101112133) LY6/PLAUR domain containing 8
domestic guinea pig(101788351) LY6/PLAUR domain containing 8
naked mole-rat(101722735) LY6/PLAUR domain containing 8
domestic cat(101084338) LY6/PLAUR domain containing 8
cow(617425) phospholipase inhibitor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301277 ANTI-LOC646627 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027339 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027339 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027339 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001085474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085474 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085474 Rosetta Predictions human pricing
XM_929570 Rosetta Predictions human pricing
NM_001109632 Rosetta Predictions rat pricing
NM_001083884 Rosetta Predictions mouse pricing
NM_027339 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317925 predicted 757
2 SASI_Hs02_00317926 predicted 649
3 SASI_Hs02_00317927 predicted 858
4 SASI_Hs02_00317928 predicted 842
5 SASI_Hs02_00317929 predicted 455
6 SASI_Hs02_00317930 predicted 520
7 SASI_Hs02_00317931 predicted 449
8 SASI_Hs02_00317932 predicted 811
9 SASI_Hs02_00317933 predicted 619
10 SASI_Hs02_00317934 predicted 920
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282229 predicted 293
2 SASI_Hs01_00282230 predicted 266
3 SASI_Hs01_00282231 predicted 278
4 SASI_Hs01_00282232 predicted 276
5 SASI_Hs01_00282233 predicted 245
6 SASI_Hs01_00282234 predicted 237
7 SASI_Hs01_00282235 predicted 275
8 SASI_Hs01_00282236 predicted 212
9 SASI_Hs01_00282237 predicted 295
10 SASI_Hs01_00282238 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109632 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250252 predicted 348
2 SASI_Rn02_00250253 predicted 418
3 SASI_Rn02_00250254 predicted 528
4 SASI_Rn02_00250255 predicted 699
5 SASI_Rn02_00250256 predicted 422
6 SASI_Rn02_00250257 predicted 604
7 SASI_Rn02_00250258 predicted 338
8 SASI_Rn02_00250259 predicted 253
9 SASI_Rn02_00250260 predicted 265
10 SASI_Rn02_00250261 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083884 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299831 predicted 206
2 SASI_Mm02_00299832 predicted 250
3 SASI_Mm02_00299833 predicted 274
4 SASI_Mm02_00299834 predicted 340
5 SASI_Mm02_00299835 predicted 487
6 SASI_Mm02_00299836 predicted 517
7 SASI_Mm02_00299837 predicted 541
8 SASI_Mm02_00299838 predicted 199
9 SASI_Mm02_00299839 predicted 600
10 SASI_Mm02_00299840 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027339 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047694 predicted 278
2 SASI_Mm02_00331972 predicted 347
3 SASI_Mm01_00047695 predicted 419
4 SASI_Mm01_00047696 predicted 446
5 SASI_Mm01_00047698 predicted 472
6 SASI_Mm01_00047700 predicted 537
7 SASI_Mm01_00047701 predicted 643
8 SASI_Mm02_00331973 predicted 319
9 SASI_Mm01_00047702 predicted 361
10 SASI_Mm01_00047703 predicted 480
11 SASI_Mm01_00047697 predicted 574
12 SASI_Mm01_00047699 predicted 596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027339
LYPD8 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 8
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-557s21c1
Sequence:CCGGATCATTGCGGAGATGGTAAATCTCGAGATTTACCATCTCCGCAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027339.2-186s1c1
Sequence:CCGGCACAGTGTTATACGTACAATACTCGAGTATTGTACGTATAACACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-313s21c1
Sequence:CCGGGTTCTGCTCCGCATCGAATTGCTCGAGCAATTCGATGCGGAGCAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-163s21c1
Sequence:CCGGAGTTGTAGACTCCCTGAATTGCTCGAGCAATTCAGGGAGTCTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-357s21c1
Sequence:CCGGCCTTCACTGTCCATCTATTTGCTCGAGCAAATAGATGGACAGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-186s21c1
Sequence:CCGGCACAGTGTTATACGTACAATACTCGAGTATTGTACGTATAACACTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027339.1-517s1c1
Sequence:CCGGGAACAATGTGTCTTCATCATTCTCGAGAATGATGAAGACACATTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027339
LYPD8 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 8
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-557s21c1
Sequence:CCGGATCATTGCGGAGATGGTAAATCTCGAGATTTACCATCTCCGCAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027339.2-186s1c1
Sequence:CCGGCACAGTGTTATACGTACAATACTCGAGTATTGTACGTATAACACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-313s21c1
Sequence:CCGGGTTCTGCTCCGCATCGAATTGCTCGAGCAATTCGATGCGGAGCAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-163s21c1
Sequence:CCGGAGTTGTAGACTCCCTGAATTGCTCGAGCAATTCAGGGAGTCTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-357s21c1
Sequence:CCGGCCTTCACTGTCCATCTATTTGCTCGAGCAAATAGATGGACAGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-186s21c1
Sequence:CCGGCACAGTGTTATACGTACAATACTCGAGTATTGTACGTATAACACTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027339.1-517s1c1
Sequence:CCGGGAACAATGTGTCTTCATCATTCTCGAGAATGATGAAGACACATTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027339
LYPD8 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 8
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-557s21c1
Sequence:CCGGATCATTGCGGAGATGGTAAATCTCGAGATTTACCATCTCCGCAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027339.2-186s1c1
Sequence:CCGGCACAGTGTTATACGTACAATACTCGAGTATTGTACGTATAACACTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-313s21c1
Sequence:CCGGGTTCTGCTCCGCATCGAATTGCTCGAGCAATTCGATGCGGAGCAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-163s21c1
Sequence:CCGGAGTTGTAGACTCCCTGAATTGCTCGAGCAATTCAGGGAGTCTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-357s21c1
Sequence:CCGGCCTTCACTGTCCATCTATTTGCTCGAGCAAATAGATGGACAGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027339.2-186s21c1
Sequence:CCGGCACAGTGTTATACGTACAATACTCGAGTATTGTACGTATAACACTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191585    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027339.1-517s1c1
Sequence:CCGGGAACAATGTGTCTTCATCATTCTCGAGAATGATGAAGACACATTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085474
LYPD8 MISSION shRNA Bacterial Glycerol Stock
LY6/PLAUR domain containing 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-785s21c1
Sequence:CCGGGGCTGTTCCAACGTCAGTAACCTCGAGGTTACTGACGTTGGAACAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-339s21c1
Sequence:CCGGTGAGCTGCGTGCAGTGTAATTCTCGAGAATTACACTGCACGCAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-449s21c1
Sequence:CCGGCTAGAGACACCAGTCAGATTACTCGAGTAATCTGACTGGTGTCTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-849s21c1
Sequence:CCGGGAGTCATCTTTCGAAAGTTTGCTCGAGCAAACTTTCGAAAGATGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-656s21c1
Sequence:CCGGCCTGCTTGTTATGAATCTAATCTCGAGATTAGATTCATAACAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085474
LYPD8 MISSION shRNA shRNA Plasmid DNA
LY6/PLAUR domain containing 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-785s21c1
Sequence:CCGGGGCTGTTCCAACGTCAGTAACCTCGAGGTTACTGACGTTGGAACAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-339s21c1
Sequence:CCGGTGAGCTGCGTGCAGTGTAATTCTCGAGAATTACACTGCACGCAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-449s21c1
Sequence:CCGGCTAGAGACACCAGTCAGATTACTCGAGTAATCTGACTGGTGTCTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-849s21c1
Sequence:CCGGGAGTCATCTTTCGAAAGTTTGCTCGAGCAAACTTTCGAAAGATGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-656s21c1
Sequence:CCGGCCTGCTTGTTATGAATCTAATCTCGAGATTAGATTCATAACAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085474
LYPD8 MISSION shRNA Lentiviral Transduction Particles
LY6/PLAUR domain containing 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-785s21c1
Sequence:CCGGGGCTGTTCCAACGTCAGTAACCTCGAGGTTACTGACGTTGGAACAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-339s21c1
Sequence:CCGGTGAGCTGCGTGCAGTGTAATTCTCGAGAATTACACTGCACGCAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-449s21c1
Sequence:CCGGCTAGAGACACCAGTCAGATTACTCGAGTAATCTGACTGGTGTCTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-849s21c1
Sequence:CCGGGAGTCATCTTTCGAAAGTTTGCTCGAGCAAACTTTCGAAAGATGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085474.1-656s21c1
Sequence:CCGGCCTGCTTGTTATGAATCTAATCTCGAGATTAGATTCATAACAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)