EMAIL THIS PAGE TO A FRIEND

LYPLA1

lysophospholipase I

126 Gene Product Result for
Synonyms: APT-1 APT1 LPL-I LPL1 hAPT1
UniProtKB ID: O75608, O43202, Q9UQF9
Gene ID:
Human(10434) Summary: This gene encodes a member of the alpha/beta hydrolase superfamily. The encoded protein functions as a homodimer, exhibiting both depalmitoylating as well as lysophospholipase activity, and may be involved in Ras localization and signaling. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 4, 6, and 7. [provided by RefSeq, Jul 2013]
Mouse(18777) lysophospholipase 1
Rat(25514) lysophospholipase I
Zebrafish(550279) lysophospholipase I
cow(539992) lysophospholipase I
domestic cat(101080683) lysophospholipase I
dog(609018) lysophospholipase I
naked mole-rat(101709662) lysophospholipase I
Domestic Rabbit(100125993) lysophospholipase I
domestic guinea pig(100715673) lysophospholipase I
sheep(101107971) lysophospholipase I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006330 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006330 Rosetta Predictions human pricing
NM_013006 Rosetta Predictions rat pricing
NM_008866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122199 predicted 922
2 SASI_Hs01_00122200 predicted 448
3 SASI_Hs01_00122201 predicted 355
4 SASI_Hs01_00122202 predicted 719
5 SASI_Hs01_00122203 predicted 451
6 SASI_Hs01_00122204 predicted 500
7 SASI_Hs01_00122205 predicted 509
8 SASI_Hs01_00122206 predicted 795
9 SASI_Hs01_00122207 predicted 676
10 SASI_Hs01_00122208 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034192 predicted 256
2 SASI_Rn01_00034193 predicted 837
3 SASI_Rn01_00034194 predicted 751
4 SASI_Rn01_00034195 predicted 264
5 SASI_Rn01_00034196 predicted 387
6 SASI_Rn01_00034197 predicted 601
7 SASI_Rn01_00034198 predicted 387
8 SASI_Rn01_00034199 predicted 327
9 SASI_Rn01_00034200 predicted 748
10 SASI_Rn01_00034201 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077476 predicted 485
2 SASI_Mm01_00077477 predicted 560
3 SASI_Mm01_00077478 predicted 419
4 SASI_Mm01_00077481 predicted 267
5 SASI_Mm01_00077482 predicted 711
6 SASI_Mm02_00314837 predicted 563
7 SASI_Mm02_00314838 predicted 552
8 SASI_Mm01_00077483 predicted 693
9 SASI_Mm01_00077484 predicted 340
10 SASI_Mm02_00314839 predicted 791
11 SASI_Mm01_00077479 predicted 239
12 SASI_Mm01_00077480 predicted 801
13 SASI_Mm01_00077485 predicted 289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006330
VALIDATED
LYPLA1 MISSION shRNA Bacterial Glycerol Stock
lysophospholipase I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006330.2-665s21c1
Sequence:CCGGCGGTGGTGCTAATAGAGATATCTCGAGATATCTCTATTAGCACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-665s1c1
Sequence:CCGGCGGTGGTGCTAATAGAGATATCTCGAGATATCTCTATTAGCACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-727s1c1
Sequence:CCGGCCCTGATGTTTGGTTCTCTTACTCGAGTAAGAGAACCAAACATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-318s1c1
Sequence:CCGGGCAGGTATCAGAAGTTCACATCTCGAGATGTGAACTTCTGATACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-498s1c1
Sequence:CCGGCAAGAAGTGAAGAATGGCATTCTCGAGAATGCCATTCTTCACTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-397s1c1
Sequence:CCGGCTATGCCTTCATGGTTTGATACTCGAGTATCAAACCATGAAGGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006330.2-727s21c1
Sequence:CCGGCCCTGATGTTTGGTTCTCTTACTCGAGTAAGAGAACCAAACATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006330.2-397s21c1
Sequence:CCGGCTATGCCTTCATGGTTTGATACTCGAGTATCAAACCATGAAGGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006330.2-498s21c1
Sequence:CCGGCAAGAAGTGAAGAATGGCATTCTCGAGAATGCCATTCTTCACTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006330
VALIDATED
LYPLA1 MISSION shRNA shRNA Plasmid DNA
lysophospholipase I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006330.2-665s21c1
Sequence:CCGGCGGTGGTGCTAATAGAGATATCTCGAGATATCTCTATTAGCACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-665s1c1
Sequence:CCGGCGGTGGTGCTAATAGAGATATCTCGAGATATCTCTATTAGCACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-727s1c1
Sequence:CCGGCCCTGATGTTTGGTTCTCTTACTCGAGTAAGAGAACCAAACATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-318s1c1
Sequence:CCGGGCAGGTATCAGAAGTTCACATCTCGAGATGTGAACTTCTGATACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-498s1c1
Sequence:CCGGCAAGAAGTGAAGAATGGCATTCTCGAGAATGCCATTCTTCACTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-397s1c1
Sequence:CCGGCTATGCCTTCATGGTTTGATACTCGAGTATCAAACCATGAAGGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006330.2-727s21c1
Sequence:CCGGCCCTGATGTTTGGTTCTCTTACTCGAGTAAGAGAACCAAACATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006330.2-397s21c1
Sequence:CCGGCTATGCCTTCATGGTTTGATACTCGAGTATCAAACCATGAAGGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006330.2-498s21c1
Sequence:CCGGCAAGAAGTGAAGAATGGCATTCTCGAGAATGCCATTCTTCACTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006330
VALIDATED
LYPLA1 MISSION shRNA Lentiviral Transduction Particles
lysophospholipase I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006330.2-665s21c1
Sequence:CCGGCGGTGGTGCTAATAGAGATATCTCGAGATATCTCTATTAGCACCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-665s1c1
Sequence:CCGGCGGTGGTGCTAATAGAGATATCTCGAGATATCTCTATTAGCACCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-727s1c1
Sequence:CCGGCCCTGATGTTTGGTTCTCTTACTCGAGTAAGAGAACCAAACATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-318s1c1
Sequence:CCGGGCAGGTATCAGAAGTTCACATCTCGAGATGTGAACTTCTGATACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-498s1c1
Sequence:CCGGCAAGAAGTGAAGAATGGCATTCTCGAGAATGCCATTCTTCACTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006330.2-397s1c1
Sequence:CCGGCTATGCCTTCATGGTTTGATACTCGAGTATCAAACCATGAAGGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006330.2-727s21c1
Sequence:CCGGCCCTGATGTTTGGTTCTCTTACTCGAGTAAGAGAACCAAACATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006330.2-397s21c1
Sequence:CCGGCTATGCCTTCATGGTTTGATACTCGAGTATCAAACCATGAAGGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006330.2-498s21c1
Sequence:CCGGCAAGAAGTGAAGAATGGCATTCTCGAGAATGCCATTCTTCACTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008866
VALIDATED
LYPLA1 MISSION shRNA Bacterial Glycerol Stock
lysophospholipase I
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008866.2-341s1c1
Sequence:CCGGGCATTCCTTCTAACAGGATTACTCGAGTAATCCTGTTAGAAGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008866.2-499s1c1
Sequence:CCGGGCTAATCGAGATATTTCCGTTCTCGAGAACGGAAATATCTCGATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008866.2-1177s1c1
Sequence:CCGGGCTAAGAATCAGATGGTATTACTCGAGTAATACCATCTGATTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008866.2-554s1c1
Sequence:CCGGCCCTAATGTTTGGTTCTCTTACTCGAGTAAGAGAACCAAACATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008866.2-499s21c1
Sequence:CCGGGCTAATCGAGATATTTCCGTTCTCGAGAACGGAAATATCTCGATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008866.2-554s21c1
Sequence:CCGGCCCTAATGTTTGGTTCTCTTACTCGAGTAAGAGAACCAAACATTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008866.2-657s1c1
Sequence:CCGGGCAGGAAATGATGGATGTCAACTCGAGTTGACATCCATCATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008866.2-1177s21c1
Sequence:CCGGGCTAAGAATCAGATGGTATTACTCGAGTAATACCATCTGATTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008866.2-341s21c1
Sequence:CCGGGCATTCCTTCTAACAGGATTACTCGAGTAATCCTGTTAGAAGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008866.2-657s21c1
Sequence:CCGGGCAGGAAATGATGGATGTCAACTCGAGTTGACATCCATCATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008866
VALIDATED
LYPLA1 MISSION shRNA shRNA Plasmid DNA
lysophospholipase I
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008866.2-341s1c1
Sequence:CCGGGCATTCCTTCTAACAGGATTACTCGAGTAATCCTGTTAGAAGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008866.2-499s1c1
Sequence:CCGGGCTAATCGAGATATTTCCGTTCTCGAGAACGGAAATATCTCGATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008866.2-1177s1c1
Sequence:CCGGGCTAAGAATCAGATGGTATTACTCGAGTAATACCATCTGATTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008866.2-554s1c1
Sequence:CCGGCCCTAATGTTTGGTTCTCTTACTCGAGTAAGAGAACCAAACATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008866.2-499s21c1
Sequence:CCGGGCTAATCGAGATATTTCCGTTCTCGAGAACGGAAATATCTCGATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008866.2-554s21c1
Sequence:CCGGCCCTAATGTTTGGTTCTCTTACTCGAGTAAGAGAACCAAACATTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008866.2-657s1c1
Sequence:CCGGGCAGGAAATGATGGATGTCAACTCGAGTTGACATCCATCATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008866.2-1177s21c1
Sequence:CCGGGCTAAGAATCAGATGGTATTACTCGAGTAATACCATCTGATTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008866.2-341s21c1
Sequence:CCGGGCATTCCTTCTAACAGGATTACTCGAGTAATCCTGTTAGAAGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008866.2-657s21c1
Sequence:CCGGGCAGGAAATGATGGATGTCAACTCGAGTTGACATCCATCATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008866
VALIDATED
LYPLA1 MISSION shRNA Lentiviral Transduction Particles
lysophospholipase I
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008866.2-341s1c1
Sequence:CCGGGCATTCCTTCTAACAGGATTACTCGAGTAATCCTGTTAGAAGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008866.2-499s1c1
Sequence:CCGGGCTAATCGAGATATTTCCGTTCTCGAGAACGGAAATATCTCGATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076853    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008866.2-1177s1c1
Sequence:CCGGGCTAAGAATCAGATGGTATTACTCGAGTAATACCATCTGATTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008866.2-554s1c1
Sequence:CCGGCCCTAATGTTTGGTTCTCTTACTCGAGTAAGAGAACCAAACATTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008866.2-499s21c1
Sequence:CCGGGCTAATCGAGATATTTCCGTTCTCGAGAACGGAAATATCTCGATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008866.2-554s21c1
Sequence:CCGGCCCTAATGTTTGGTTCTCTTACTCGAGTAAGAGAACCAAACATTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008866.2-657s1c1
Sequence:CCGGGCAGGAAATGATGGATGTCAACTCGAGTTGACATCCATCATTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008866.2-1177s21c1
Sequence:CCGGGCTAAGAATCAGATGGTATTACTCGAGTAATACCATCTGATTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008866.2-341s21c1
Sequence:CCGGGCATTCCTTCTAACAGGATTACTCGAGTAATCCTGTTAGAAGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008866.2-657s21c1
Sequence:CCGGGCAGGAAATGATGGATGTCAACTCGAGTTGACATCCATCATTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)