EMAIL THIS PAGE TO A FRIEND

LYPLA2

lysophospholipase II

167 Gene Product Result for
Synonyms: APT-2 DJ886K2.4
UniProtKB ID: O95372, Q7Z4Z2
Gene ID:
Human(11313) Summary: Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. There are alternatively spliced transcript variants described for this gene but the full length nature is not known yet. [provided by RefSeq, Jul 2008]
Mouse(26394) lysophospholipase 2
Rat(83510) lysophospholipase II
Zebrafish(393722) lysophospholipase II
chicken(419685) lysophospholipase II
domestic cat(101099061) lysophospholipase II
cow(784764) lysophospholipase II
dog(487374) lysophospholipase II
sheep(101120388) lysophospholipase II
domestic guinea pig(100713567) lysophospholipase II
naked mole-rat(101714284) lysophospholipase II
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007260 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007260 Rosetta Predictions human pricing
NM_031342 Rosetta Predictions rat pricing
NM_011942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343283 predicted 422
2 SASI_Hs02_00343284 predicted 680
3 SASI_Hs02_00343285 predicted 1251
4 SASI_Hs02_00343286 predicted 305
5 SASI_Hs02_00343287 predicted 1121
6 SASI_Hs02_00343288 predicted 373
7 SASI_Hs02_00343289 predicted 298
8 SASI_Hs02_00343290 predicted 979
9 SASI_Hs02_00343291 predicted 384
10 SASI_Hs02_00343292 predicted 462
11 SASI_Hs01_00120742 predicted 869
12 SASI_Hs01_00120743 predicted 463
13 SASI_Hs01_00120744 predicted 867
14 SASI_Hs01_00120745 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045120 predicted 407
2 SASI_Rn01_00045121 predicted 385
3 SASI_Rn01_00045122 predicted 1151
4 SASI_Rn01_00045123 predicted 273
5 SASI_Rn01_00045124 predicted 640
6 SASI_Rn01_00045125 predicted 265
7 SASI_Rn01_00045126 predicted 426
8 SASI_Rn01_00045128 predicted 368
9 SASI_Rn01_00045129 predicted 288
10 SASI_Rn02_00264577 predicted 611
11 SASI_Rn01_00045127 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051133 predicted 845
2 SASI_Mm01_00051135 predicted 859
3 SASI_Mm01_00051136 predicted 666
4 SASI_Mm01_00051137 predicted 428
5 SASI_Mm01_00051138 predicted 446
6 SASI_Mm01_00051139 predicted 516
7 SASI_Mm02_00321801 predicted 1103
8 SASI_Mm01_00051140 predicted 393
9 SASI_Mm01_00051141 predicted 626
10 SASI_Mm01_00051142 predicted 312
11 SASI_Mm01_00051134 predicted 580
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011942
VALIDATED
LYPLA2 MISSION shRNA Bacterial Glycerol Stock
lysophospholipase II
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011942.1-419s21c1
Sequence:CCGGATGAGATGAAGAACGGGATTCCTCGAGGAATCCCGTTCTTCATCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011942.1-394s21c1
Sequence:CCGGGAGAACATCAAGGCTTTGATTCTCGAGAATCAAAGCCTTGATGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011942.1-1189s21c1
Sequence:CCGGCCCATGACTCTGCCCGGATAACTCGAGTTATCCGGGCAGAGTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011942.1-747s21c1
Sequence:CCGGTCAGGAGATGGCAGCTGTAAACTCGAGTTTACAGCTGCCATCTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011942.1-699s21c1
Sequence:CCGGCAGGGTCCAGTTTAAGACATACTCGAGTATGTCTTAAACTGGACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011942.1-1189s1c1
Sequence:CCGGCCCATGACTCTGCCCGGATAACTCGAGTTATCCGGGCAGAGTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011942.1-249s1c1
Sequence:CCGGGCTTCCTCATGTCAAGTACATCTCGAGATGTACTTGACATGAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011942.1-485s1c1
Sequence:CCGGTGTCCCTCTATACAGCACTTACTCGAGTAAGTGCTGTATAGAGGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011942.1-699s1c1
Sequence:CCGGCAGGGTCCAGTTTAAGACATACTCGAGTATGTCTTAAACTGGACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011942.1-394s1c1
Sequence:CCGGGAGAACATCAAGGCTTTGATTCTCGAGAATCAAAGCCTTGATGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011942
VALIDATED
LYPLA2 MISSION shRNA shRNA Plasmid DNA
lysophospholipase II
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011942.1-419s21c1
Sequence:CCGGATGAGATGAAGAACGGGATTCCTCGAGGAATCCCGTTCTTCATCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011942.1-394s21c1
Sequence:CCGGGAGAACATCAAGGCTTTGATTCTCGAGAATCAAAGCCTTGATGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011942.1-1189s21c1
Sequence:CCGGCCCATGACTCTGCCCGGATAACTCGAGTTATCCGGGCAGAGTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011942.1-747s21c1
Sequence:CCGGTCAGGAGATGGCAGCTGTAAACTCGAGTTTACAGCTGCCATCTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011942.1-699s21c1
Sequence:CCGGCAGGGTCCAGTTTAAGACATACTCGAGTATGTCTTAAACTGGACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011942.1-1189s1c1
Sequence:CCGGCCCATGACTCTGCCCGGATAACTCGAGTTATCCGGGCAGAGTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011942.1-249s1c1
Sequence:CCGGGCTTCCTCATGTCAAGTACATCTCGAGATGTACTTGACATGAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011942.1-485s1c1
Sequence:CCGGTGTCCCTCTATACAGCACTTACTCGAGTAAGTGCTGTATAGAGGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011942.1-699s1c1
Sequence:CCGGCAGGGTCCAGTTTAAGACATACTCGAGTATGTCTTAAACTGGACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011942.1-394s1c1
Sequence:CCGGGAGAACATCAAGGCTTTGATTCTCGAGAATCAAAGCCTTGATGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011942
VALIDATED
LYPLA2 MISSION shRNA Lentiviral Transduction Particles
lysophospholipase II
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011942.1-419s21c1
Sequence:CCGGATGAGATGAAGAACGGGATTCCTCGAGGAATCCCGTTCTTCATCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011942.1-394s21c1
Sequence:CCGGGAGAACATCAAGGCTTTGATTCTCGAGAATCAAAGCCTTGATGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011942.1-1189s21c1
Sequence:CCGGCCCATGACTCTGCCCGGATAACTCGAGTTATCCGGGCAGAGTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011942.1-747s21c1
Sequence:CCGGTCAGGAGATGGCAGCTGTAAACTCGAGTTTACAGCTGCCATCTCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011942.1-699s21c1
Sequence:CCGGCAGGGTCCAGTTTAAGACATACTCGAGTATGTCTTAAACTGGACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076858    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011942.1-1189s1c1
Sequence:CCGGCCCATGACTCTGCCCGGATAACTCGAGTTATCCGGGCAGAGTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011942.1-249s1c1
Sequence:CCGGGCTTCCTCATGTCAAGTACATCTCGAGATGTACTTGACATGAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011942.1-485s1c1
Sequence:CCGGTGTCCCTCTATACAGCACTTACTCGAGTAAGTGCTGTATAGAGGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011942.1-699s1c1
Sequence:CCGGCAGGGTCCAGTTTAAGACATACTCGAGTATGTCTTAAACTGGACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011942.1-394s1c1
Sequence:CCGGGAGAACATCAAGGCTTTGATTCTCGAGAATCAAAGCCTTGATGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007260
VALIDATED
LYPLA2 MISSION shRNA Bacterial Glycerol Stock
lysophospholipase II
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-773s21c1
Sequence:CCGGGCAGCTGTGAAGGAATTTCTTCTCGAGAAGAAATTCCTTCACAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-715s21c1
Sequence:CCGGCAGGGTCCAGTTCAAGACATACTCGAGTATGTCTTGAACTGGACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-433s21c1
Sequence:CCGGGCATGAAATGAAGAACGGGATCTCGAGATCCCGTTCTTCATTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-269s21c1
Sequence:CCGGCCTCACGTCAAGTACATCTGTCTCGAGACAGATGTACTTGACGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-1024s21c1
Sequence:CCGGGGCTGCTTTCTTATCCATTTCCTCGAGGAAATGGATAAGAAAGCAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007260.2-433s1c1
Sequence:CCGGGCATGAAATGAAGAACGGGATCTCGAGATCCCGTTCTTCATTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007260.2-269s1c1
Sequence:CCGGCCTCACGTCAAGTACATCTGTCTCGAGACAGATGTACTTGACGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007260.2-464s1c1
Sequence:CCGGCGAATCGTCCTGGGAGGCTTTCTCGAGAAAGCCTCCCAGGACGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007260.2-715s1c1
Sequence:CCGGCAGGGTCCAGTTCAAGACATACTCGAGTATGTCTTGAACTGGACCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007260.2-773s1c1
Sequence:CCGGGCAGCTGTGAAGGAATTTCTTCTCGAGAAGAAATTCCTTCACAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007260
VALIDATED
LYPLA2 MISSION shRNA shRNA Plasmid DNA
lysophospholipase II
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-773s21c1
Sequence:CCGGGCAGCTGTGAAGGAATTTCTTCTCGAGAAGAAATTCCTTCACAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-715s21c1
Sequence:CCGGCAGGGTCCAGTTCAAGACATACTCGAGTATGTCTTGAACTGGACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-433s21c1
Sequence:CCGGGCATGAAATGAAGAACGGGATCTCGAGATCCCGTTCTTCATTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-269s21c1
Sequence:CCGGCCTCACGTCAAGTACATCTGTCTCGAGACAGATGTACTTGACGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-1024s21c1
Sequence:CCGGGGCTGCTTTCTTATCCATTTCCTCGAGGAAATGGATAAGAAAGCAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007260.2-433s1c1
Sequence:CCGGGCATGAAATGAAGAACGGGATCTCGAGATCCCGTTCTTCATTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007260.2-269s1c1
Sequence:CCGGCCTCACGTCAAGTACATCTGTCTCGAGACAGATGTACTTGACGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007260.2-464s1c1
Sequence:CCGGCGAATCGTCCTGGGAGGCTTTCTCGAGAAAGCCTCCCAGGACGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007260.2-715s1c1
Sequence:CCGGCAGGGTCCAGTTCAAGACATACTCGAGTATGTCTTGAACTGGACCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007260.2-773s1c1
Sequence:CCGGGCAGCTGTGAAGGAATTTCTTCTCGAGAAGAAATTCCTTCACAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007260
VALIDATED
LYPLA2 MISSION shRNA Lentiviral Transduction Particles
lysophospholipase II
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-773s21c1
Sequence:CCGGGCAGCTGTGAAGGAATTTCTTCTCGAGAAGAAATTCCTTCACAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-715s21c1
Sequence:CCGGCAGGGTCCAGTTCAAGACATACTCGAGTATGTCTTGAACTGGACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-433s21c1
Sequence:CCGGGCATGAAATGAAGAACGGGATCTCGAGATCCCGTTCTTCATTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-269s21c1
Sequence:CCGGCCTCACGTCAAGTACATCTGTCTCGAGACAGATGTACTTGACGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007260.2-1024s21c1
Sequence:CCGGGGCTGCTTTCTTATCCATTTCCTCGAGGAAATGGATAAGAAAGCAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007260.2-433s1c1
Sequence:CCGGGCATGAAATGAAGAACGGGATCTCGAGATCCCGTTCTTCATTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007260.2-269s1c1
Sequence:CCGGCCTCACGTCAAGTACATCTGTCTCGAGACAGATGTACTTGACGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007260.2-464s1c1
Sequence:CCGGCGAATCGTCCTGGGAGGCTTTCTCGAGAAAGCCTCCCAGGACGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007260.2-715s1c1
Sequence:CCGGCAGGGTCCAGTTCAAGACATACTCGAGTATGTCTTGAACTGGACCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007260.2-773s1c1
Sequence:CCGGGCAGCTGTGAAGGAATTTCTTCTCGAGAAGAAATTCCTTCACAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)