EMAIL THIS PAGE TO A FRIEND

LYPLAL1

lysophospholipase-like 1

207 Gene Product Result for
UniProtKB ID: Q5VWZ2, A8K677, Q5VWZ3, Q7Z4A3, Q96AV0
Gene ID:
Mouse(226791) lysophospholipase-like 1
Rat(289357) lysophospholipase-like 1
chicken(421351) lysophospholipase-like 1
dog(488598) lysophospholipase-like 1
cow(533920) lysophospholipase-like 1
domestic cat(101094568) lysophospholipase-like 1
naked mole-rat(101708065) lysophospholipase-like 1
domestic guinea pig(100716841) lysophospholipase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138794 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138794 Rosetta Predictions human pricing
NM_001105986 Rosetta Predictions rat pricing
NM_146106 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363940 predicted 463
2 SASI_Hs01_00131248 predicted 325
3 SASI_Hs02_00363941 predicted 522
4 SASI_Hs02_00363942 predicted 691
5 SASI_Hs02_00363943 predicted 764
6 SASI_Hs02_00363944 predicted 295
7 SASI_Hs01_00131254 predicted 501
8 SASI_Hs02_00363945 predicted 699
9 SASI_Hs02_00363946 predicted 315
10 SASI_Hs02_00363947 predicted 379
11 SASI_Hs01_00131247 predicted 568
12 SASI_Hs01_00131249 predicted 281
13 SASI_Hs01_00131250 predicted 241
14 SASI_Hs01_00131251 predicted 404
15 SASI_Hs01_00131252 predicted 396
16 SASI_Hs01_00131253 predicted 345
17 SASI_Hs01_00131255 predicted 228
18 SASI_Hs01_00131256 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105986 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214502 predicted 666
2 SASI_Rn02_00214503 predicted 995
3 SASI_Rn02_00214504 predicted 896
4 SASI_Rn02_00214505 predicted 521
5 SASI_Rn02_00214506 predicted 623
6 SASI_Rn02_00214507 predicted 760
7 SASI_Rn02_00214508 predicted 360
8 SASI_Rn02_00214509 predicted 1130
9 SASI_Rn02_00214510 predicted 1208
10 SASI_Rn02_00214511 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158529 predicted 788
2 SASI_Mm01_00158530 predicted 1067
3 SASI_Mm01_00158531 predicted 275
4 SASI_Mm01_00158532 predicted 866
5 SASI_Mm01_00158534 predicted 325
6 SASI_Mm01_00158535 predicted 717
7 SASI_Mm01_00158536 predicted 593
8 SASI_Mm01_00158537 predicted 885
9 SASI_Mm02_00341752 predicted 945
10 SASI_Mm02_00341753 predicted 716
11 SASI_Mm01_00158533 predicted 289
12 SASI_Mm01_00158538 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138794
VALIDATED
LYPLAL1 MISSION shRNA Bacterial Glycerol Stock
lysophospholipase-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138794.1-546s1c1
Sequence:CCGGGCAGATGAGTTAGTTCTTCATCTCGAGATGAAGAACTAACTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138794.1-442s1c1
Sequence:CCGGGAGTATTTGCTCTTTCTAGTTCTCGAGAACTAGAAAGAGCAAATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138794.1-633s1c1
Sequence:CCGGCCAAATGTTTACCATGAGCTACTCGAGTAGCTCATGGTAAACATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138794.1-274s1c1
Sequence:CCGGGCCCAGAACACCTTGAATCAACTCGAGTTGATTCAAGGTGTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138794.1-200s1c1
Sequence:CCGGTCCCAGATCATATACTCCTATCTCGAGATAGGAGTATATGATCTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138794.3-1056s21c1
Sequence:CCGGATGAAAGGACTTAGCATAATGCTCGAGCATTATGCTAAGTCCTTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138794.3-1174s21c1
Sequence:CCGGTAAACCGGTTTCACATTATTTCTCGAGAAATAATGTGAAACCGGTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138794.3-537s21c1
Sequence:CCGGGGTGTACTTCCTGAATTATTTCTCGAGAAATAATTCAGGAAGTACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138794.3-888s21c1
Sequence:CCGGCACTGTAGACAGTAGCTAATCCTCGAGGATTAGCTACTGTCTACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138794.3-631s21c1
Sequence:CCGGTAGGAGTGACCACGAAGTTTCCTCGAGGAAACTTCGTGGTCACTCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138794
VALIDATED
LYPLAL1 MISSION shRNA shRNA Plasmid DNA
lysophospholipase-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138794.1-546s1c1
Sequence:CCGGGCAGATGAGTTAGTTCTTCATCTCGAGATGAAGAACTAACTCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138794.1-442s1c1
Sequence:CCGGGAGTATTTGCTCTTTCTAGTTCTCGAGAACTAGAAAGAGCAAATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138794.1-633s1c1
Sequence:CCGGCCAAATGTTTACCATGAGCTACTCGAGTAGCTCATGGTAAACATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138794.1-274s1c1
Sequence:CCGGGCCCAGAACACCTTGAATCAACTCGAGTTGATTCAAGGTGTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138794.1-200s1c1
Sequence:CCGGTCCCAGATCATATACTCCTATCTCGAGATAGGAGTATATGATCTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138794.3-1056s21c1
Sequence:CCGGATGAAAGGACTTAGCATAATGCTCGAGCATTATGCTAAGTCCTTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138794.3-1174s21c1
Sequence:CCGGTAAACCGGTTTCACATTATTTCTCGAGAAATAATGTGAAACCGGTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138794.3-537s21c1
Sequence:CCGGGGTGTACTTCCTGAATTATTTCTCGAGAAATAATTCAGGAAGTACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138794.3-888s21c1
Sequence:CCGGCACTGTAGACAGTAGCTAATCCTCGAGGATTAGCTACTGTCTACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138794.3-631s21c1
Sequence:CCGGTAGGAGTGACCACGAAGTTTCCTCGAGGAAACTTCGTGGTCACTCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138794
VALIDATED
LYPLAL1 MISSION shRNA Lentiviral Transduction Particles
lysophospholipase-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138794.1-546s1c1
Sequence:CCGGGCAGATGAGTTAGTTCTTCATCTCGAGATGAAGAACTAACTCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138794.1-442s1c1
Sequence:CCGGGAGTATTTGCTCTTTCTAGTTCTCGAGAACTAGAAAGAGCAAATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138794.1-633s1c1
Sequence:CCGGCCAAATGTTTACCATGAGCTACTCGAGTAGCTCATGGTAAACATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_138794.1-274s1c1
Sequence:CCGGGCCCAGAACACCTTGAATCAACTCGAGTTGATTCAAGGTGTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138794.1-200s1c1
Sequence:CCGGTCCCAGATCATATACTCCTATCTCGAGATAGGAGTATATGATCTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138794.3-1056s21c1
Sequence:CCGGATGAAAGGACTTAGCATAATGCTCGAGCATTATGCTAAGTCCTTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138794.3-1174s21c1
Sequence:CCGGTAAACCGGTTTCACATTATTTCTCGAGAAATAATGTGAAACCGGTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138794.3-537s21c1
Sequence:CCGGGGTGTACTTCCTGAATTATTTCTCGAGAAATAATTCAGGAAGTACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138794.3-888s21c1
Sequence:CCGGCACTGTAGACAGTAGCTAATCCTCGAGGATTAGCTACTGTCTACAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138794.3-631s21c1
Sequence:CCGGTAGGAGTGACCACGAAGTTTCCTCGAGGAAACTTCGTGGTCACTCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146106
VALIDATED
LYPLAL1 MISSION shRNA Bacterial Glycerol Stock
lysophospholipase-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146106.1-491s1c1
Sequence:CCGGGAGTGTTTGTTCTTTCTGGTTCTCGAGAACCAGAAAGAACAAACACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146106.1-189s1c1
Sequence:CCGGGCACGTGCTAAACCAAGACTTCTCGAGAAGTCTTGGTTTAGCACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146106.1-205s1c1
Sequence:CCGGGACTTAACATTCCAGCACATACTCGAGTATGTGCTGGAATGTTAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146106.1-595s1c1
Sequence:CCGGGCAGATAACCTAGTTCTGCATCTCGAGATGCAGAACTAGGTTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146106.1-1143s1c1
Sequence:CCGGGCTGCTTCTCAATGTGGCTTTCTCGAGAAAGCCACATTGAGAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146106
VALIDATED
LYPLAL1 MISSION shRNA shRNA Plasmid DNA
lysophospholipase-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146106.1-491s1c1
Sequence:CCGGGAGTGTTTGTTCTTTCTGGTTCTCGAGAACCAGAAAGAACAAACACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146106.1-189s1c1
Sequence:CCGGGCACGTGCTAAACCAAGACTTCTCGAGAAGTCTTGGTTTAGCACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146106.1-205s1c1
Sequence:CCGGGACTTAACATTCCAGCACATACTCGAGTATGTGCTGGAATGTTAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146106.1-595s1c1
Sequence:CCGGGCAGATAACCTAGTTCTGCATCTCGAGATGCAGAACTAGGTTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146106.1-1143s1c1
Sequence:CCGGGCTGCTTCTCAATGTGGCTTTCTCGAGAAAGCCACATTGAGAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146106
VALIDATED
LYPLAL1 MISSION shRNA Lentiviral Transduction Particles
lysophospholipase-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146106.1-491s1c1
Sequence:CCGGGAGTGTTTGTTCTTTCTGGTTCTCGAGAACCAGAAAGAACAAACACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146106.1-189s1c1
Sequence:CCGGGCACGTGCTAAACCAAGACTTCTCGAGAAGTCTTGGTTTAGCACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146106.1-205s1c1
Sequence:CCGGGACTTAACATTCCAGCACATACTCGAGTATGTGCTGGAATGTTAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146106.1-595s1c1
Sequence:CCGGGCAGATAACCTAGTTCTGCATCTCGAGATGCAGAACTAGGTTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_146106.1-1143s1c1
Sequence:CCGGGCTGCTTCTCAATGTGGCTTTCTCGAGAAAGCCACATTGAGAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)