EMAIL THIS PAGE TO A FRIEND

LYRM1

LYR motif containing 1

76 Gene Product Result for
Synonyms: A211C6.1
UniProtKB ID: O43325, B2R4M5
Gene ID:
Mouse(73919) LYR motif containing 1
Rat(365361) LYR motif containing 1
Goat(100861062) LYR motif containing 1
sheep(101122751) LYR motif containing 1
domestic guinea pig(100717136) LYR motif containing 1
naked mole-rat(101698897) LYR motif containing 1
Zebrafish(436779) LYR motif containing 1
domestic cat(101081513) LYR motif containing 1
cow(508417) LYR motif containing 1
dog(489982) LYR motif containing 1
chicken(427003) LYR motif containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500160 Anti-LYRM1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2107271 Anti-LYRM1 antibody produced in rabbit affinity isolated antibody human, rabbit, guinea pig, horse
ELISA, western blot pricing
HPA059840 Anti-LYRM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020424 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128301 Rosetta Predictions human pricing
NM_001128302 Rosetta Predictions human pricing
NM_020424 Rosetta Predictions human pricing
NM_001108918 Rosetta Predictions rat pricing
NM_029610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331006 predicted 537
2 SASI_Hs02_00331007 predicted 612
3 SASI_Hs02_00331008 predicted 657
4 SASI_Hs02_00331009 predicted 717
5 SASI_Hs02_00331010 predicted 384
6 SASI_Hs02_00331011 predicted 759
7 SASI_Hs02_00331012 predicted 492
8 SASI_Hs02_00331013 predicted 550
9 SASI_Hs02_00331014 predicted 422
10 SASI_Hs02_00331015 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331016 predicted 306
2 SASI_Hs02_00331017 predicted 382
3 SASI_Hs02_00331018 predicted 492
4 SASI_Hs02_00331019 predicted 425
5 SASI_Hs02_00331020 predicted 480
6 SASI_Hs02_00331021 predicted 534
7 SASI_Hs02_00331022 predicted 259
8 SASI_Hs02_00331023 predicted 313
9 SASI_Hs02_00331024 predicted 657
10 SASI_Hs02_00331025 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039171 predicted 567
2 SASI_Hs02_00353434 predicted 645
3 SASI_Hs01_00039173 predicted 694
4 SASI_Hs01_00039174 predicted 749
5 SASI_Hs01_00039175 predicted 413
6 SASI_Hs01_00039176 predicted 797
7 SASI_Hs01_00039178 predicted 527
8 SASI_Hs01_00039179 predicted 579
9 SASI_Hs01_00039180 predicted 458
10 SASI_Hs02_00353435 predicted 919
11 SASI_Hs01_00039172 predicted 805
12 SASI_Hs01_00039177 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243374 predicted 616
2 SASI_Rn02_00243375 predicted 368
3 SASI_Rn02_00243376 predicted 401
4 SASI_Rn02_00243377 predicted 530
5 SASI_Rn02_00243378 predicted 371
6 SASI_Rn02_00243379 predicted 205
7 SASI_Rn02_00243380 predicted 414
8 SASI_Rn02_00243381 predicted 812
9 SASI_Rn02_00243382 predicted 772
10 SASI_Rn02_00243383 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039168 predicted 945
2 SASI_Mm01_00039169 predicted 971
3 SASI_Mm01_00039170 predicted 948
4 SASI_Mm01_00039171 predicted 614
5 SASI_Mm01_00039172 predicted 734
6 SASI_Mm01_00039173 predicted 821
7 SASI_Mm01_00039174 predicted 580
8 SASI_Mm01_00039175 predicted 1020
9 SASI_Mm01_00039176 predicted 759
10 SASI_Mm01_00039177 predicted 983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020424
VALIDATED
LYRM1 MISSION shRNA Bacterial Glycerol Stock
LYR motif containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-362s21c1
Sequence:CCGGAGGAAATGGCAGGCGACATCACTCGAGTGATGTCGCCTGCCATTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-330s21c1
Sequence:CCGGTTGGCCTCTACCGCAGCATTTCTCGAGAAATGCTGCGGTAGAGGCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-1023s21c1
Sequence:CCGGAGTTACTGTGGCTACTATAAACTCGAGTTTATAGTAGCCACAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-667s21c1
Sequence:CCGGCTAATCTAGAGGAAAGTTTATCTCGAGATAAACTTTCCTCTAGATTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-471s21c1
Sequence:CCGGCAGACCTAATTAAACAGTGTACTCGAGTACACTGTTTAATTAGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_020424.2-734s1c1
Sequence:CCGGCCAGTATATCTCAGATCTCATCTCGAGATGAGATCTGAGATATACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_020424.2-484s1c1
Sequence:CCGGGCAGATGGAAGACACCATCAACTCGAGTTGATGGTGTCTTCCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_020424.2-622s1c1
Sequence:CCGGACTGCATTACAAGATTCCTTACTCGAGTAAGGAATCTTGTAATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020424.2-570s1c1
Sequence:CCGGCAGACCTAATTAAACAGTGTACTCGAGTACACTGTTTAATTAGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_020424.2-649s1c1
Sequence:CCGGGCCAATTCATCTGCCTCCAATCTCGAGATTGGAGGCAGATGAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020424
VALIDATED
LYRM1 MISSION shRNA shRNA Plasmid DNA
LYR motif containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-362s21c1
Sequence:CCGGAGGAAATGGCAGGCGACATCACTCGAGTGATGTCGCCTGCCATTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-330s21c1
Sequence:CCGGTTGGCCTCTACCGCAGCATTTCTCGAGAAATGCTGCGGTAGAGGCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-1023s21c1
Sequence:CCGGAGTTACTGTGGCTACTATAAACTCGAGTTTATAGTAGCCACAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-667s21c1
Sequence:CCGGCTAATCTAGAGGAAAGTTTATCTCGAGATAAACTTTCCTCTAGATTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-471s21c1
Sequence:CCGGCAGACCTAATTAAACAGTGTACTCGAGTACACTGTTTAATTAGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_020424.2-734s1c1
Sequence:CCGGCCAGTATATCTCAGATCTCATCTCGAGATGAGATCTGAGATATACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_020424.2-484s1c1
Sequence:CCGGGCAGATGGAAGACACCATCAACTCGAGTTGATGGTGTCTTCCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_020424.2-622s1c1
Sequence:CCGGACTGCATTACAAGATTCCTTACTCGAGTAAGGAATCTTGTAATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020424.2-570s1c1
Sequence:CCGGCAGACCTAATTAAACAGTGTACTCGAGTACACTGTTTAATTAGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_020424.2-649s1c1
Sequence:CCGGGCCAATTCATCTGCCTCCAATCTCGAGATTGGAGGCAGATGAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020424
VALIDATED
LYRM1 MISSION shRNA Lentiviral Transduction Particles
LYR motif containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-362s21c1
Sequence:CCGGAGGAAATGGCAGGCGACATCACTCGAGTGATGTCGCCTGCCATTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-330s21c1
Sequence:CCGGTTGGCCTCTACCGCAGCATTTCTCGAGAAATGCTGCGGTAGAGGCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-1023s21c1
Sequence:CCGGAGTTACTGTGGCTACTATAAACTCGAGTTTATAGTAGCCACAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-667s21c1
Sequence:CCGGCTAATCTAGAGGAAAGTTTATCTCGAGATAAACTTTCCTCTAGATTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_020424.3-471s21c1
Sequence:CCGGCAGACCTAATTAAACAGTGTACTCGAGTACACTGTTTAATTAGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_020424.2-734s1c1
Sequence:CCGGCCAGTATATCTCAGATCTCATCTCGAGATGAGATCTGAGATATACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_020424.2-484s1c1
Sequence:CCGGGCAGATGGAAGACACCATCAACTCGAGTTGATGGTGTCTTCCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_020424.2-622s1c1
Sequence:CCGGACTGCATTACAAGATTCCTTACTCGAGTAAGGAATCTTGTAATGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020424.2-570s1c1
Sequence:CCGGCAGACCTAATTAAACAGTGTACTCGAGTACACTGTTTAATTAGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_020424.2-649s1c1
Sequence:CCGGGCCAATTCATCTGCCTCCAATCTCGAGATTGGAGGCAGATGAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029610
LYRM1 MISSION shRNA Bacterial Glycerol Stock
LYR motif containing 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029610.1-638s1c1
Sequence:CCGGGACTGCATTACCAGATCCCTTCTCGAGAAGGGATCTGGTAATGCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029610.1-504s1c1
Sequence:CCGGGATGGAAGACACCATCGAAGACTCGAGTCTTCGATGGTGTCTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029610.1-1117s1c1
Sequence:CCGGGCAAGTTCACATGGCTCCAAACTCGAGTTTGGAGCCATGTGAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029610.1-589s1c1
Sequence:CCGGGAGCTGATTAAACAATGCATACTCGAGTATGCATTGTTTAATCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200206    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029610.1-1090s1c1
Sequence:CCGGCGGATGCAAAGGGATTAGCTACTCGAGTAGCTAATCCCTTTGCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029610.1-746s1c1
Sequence:CCGGCCAAACCAGTGTATCTGAAGTCTCGAGACTTCAGATACACTGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029610
LYRM1 MISSION shRNA shRNA Plasmid DNA
LYR motif containing 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029610.1-638s1c1
Sequence:CCGGGACTGCATTACCAGATCCCTTCTCGAGAAGGGATCTGGTAATGCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029610.1-504s1c1
Sequence:CCGGGATGGAAGACACCATCGAAGACTCGAGTCTTCGATGGTGTCTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029610.1-1117s1c1
Sequence:CCGGGCAAGTTCACATGGCTCCAAACTCGAGTTTGGAGCCATGTGAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029610.1-589s1c1
Sequence:CCGGGAGCTGATTAAACAATGCATACTCGAGTATGCATTGTTTAATCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200206    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029610.1-1090s1c1
Sequence:CCGGCGGATGCAAAGGGATTAGCTACTCGAGTAGCTAATCCCTTTGCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029610.1-746s1c1
Sequence:CCGGCCAAACCAGTGTATCTGAAGTCTCGAGACTTCAGATACACTGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029610
LYRM1 MISSION shRNA Lentiviral Transduction Particles
LYR motif containing 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029610.1-638s1c1
Sequence:CCGGGACTGCATTACCAGATCCCTTCTCGAGAAGGGATCTGGTAATGCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029610.1-504s1c1
Sequence:CCGGGATGGAAGACACCATCGAAGACTCGAGTCTTCGATGGTGTCTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029610.1-1117s1c1
Sequence:CCGGGCAAGTTCACATGGCTCCAAACTCGAGTTTGGAGCCATGTGAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029610.1-589s1c1
Sequence:CCGGGAGCTGATTAAACAATGCATACTCGAGTATGCATTGTTTAATCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200206    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029610.1-1090s1c1
Sequence:CCGGCGGATGCAAAGGGATTAGCTACTCGAGTAGCTAATCCCTTTGCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029610.1-746s1c1
Sequence:CCGGCCAAACCAGTGTATCTGAAGTCTCGAGACTTCAGATACACTGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)