EMAIL THIS PAGE TO A FRIEND

LYRM4

LYR motif containing 4

69 Gene Product Result for
Synonyms: C6orf149 CGI-203 ISD11
UniProtKB ID: Q9HD34, A8K543, Q5XKP1
Gene ID:
Mouse(380840) LYR motif containing 4
Rat(100363003) LYR motif containing 4
sheep(101109130) LYR motif containing 4
domestic guinea pig(101788367) LYR motif containing 4
naked mole-rat(101719586) LYR motif containing 4
Zebrafish(100302660) LYR motif containing 4
cow(614011) LYR motif containing 4
domestic cat(101081544) LYR motif containing 4
chicken(420874) LYR motif containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020408 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020408 Rosetta Predictions human pricing
NM_201358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353407 predicted 619
2 SASI_Hs02_00353408 predicted 652
3 SASI_Hs01_00043929 predicted 420
4 SASI_Hs02_00353409 predicted 769
5 SASI_Hs01_00043930 predicted 519
6 SASI_Hs01_00043932 predicted 644
7 SASI_Hs01_00043933 predicted 612
8 SASI_Hs02_00353410 predicted 579
9 SASI_Hs01_00043935 predicted 593
10 SASI_Hs01_00043936 predicted 791
11 SASI_Hs01_00043931 predicted 649
12 SASI_Hs01_00043934 predicted 435
13 SASI_Hs01_00043937 predicted 412
14 SASI_Hs01_00043938 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090262 predicted 750
2 SASI_Mm01_00090263 predicted 427
3 SASI_Mm01_00090264 predicted 884
4 SASI_Mm01_00090265 predicted 928
5 SASI_Mm01_00090266 predicted 691
6 SASI_Mm01_00090267 predicted 465
7 SASI_Mm01_00090269 predicted 783
8 SASI_Mm01_00090270 predicted 838
9 SASI_Mm01_00090271 predicted 699
10 SASI_Mm02_00351515 predicted 402
11 SASI_Mm01_00090268 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020408
VALIDATED
LYRM4 MISSION shRNA Bacterial Glycerol Stock
LYR motif containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-337s21c1
Sequence:CCGGTGTAAAGGATCCTGTAGAAATCTCGAGATTTCTACAGGATCCTTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-445s21c1
Sequence:CCGGGATCATTGAGAATCGAGACATCTCGAGATGTCTCGATTCTCAATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-761s21c1
Sequence:CCGGGACCATTGTGTATAGCATTTCCTCGAGGAAATGCTATACACAATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-275s21c1
Sequence:CCGGGCCTACAATTACAGAACATATCTCGAGATATGTTCTGTAATTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-251s21c1
Sequence:CCGGCTGAGAGAGAGCAAGCGTTTCCTCGAGGAAACGCTTGCTCTCTCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_020408.3-301s1c1
Sequence:CCGGCAGGAGGATAAGAGATGCCTTCTCGAGAAGGCATCTCTTATCCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020408.3-275s1c1
Sequence:CCGGGCCTACAATTACAGAACATATCTCGAGATATGTTCTGTAATTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020408.3-378s1c1
Sequence:CCGGCCAAGAGAGACCTTGGAGTAACTCGAGTTACTCCAAGGTCTCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_020408.3-445s1c1
Sequence:CCGGGATCATTGAGAATCGAGACATCTCGAGATGTCTCGATTCTCAATGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_020408.3-421s1c1
Sequence:CCGGCCAACTGTATTCAACTGACAACTCGAGTTGTCAGTTGAATACAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020408
VALIDATED
LYRM4 MISSION shRNA shRNA Plasmid DNA
LYR motif containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-337s21c1
Sequence:CCGGTGTAAAGGATCCTGTAGAAATCTCGAGATTTCTACAGGATCCTTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-445s21c1
Sequence:CCGGGATCATTGAGAATCGAGACATCTCGAGATGTCTCGATTCTCAATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-761s21c1
Sequence:CCGGGACCATTGTGTATAGCATTTCCTCGAGGAAATGCTATACACAATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-275s21c1
Sequence:CCGGGCCTACAATTACAGAACATATCTCGAGATATGTTCTGTAATTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-251s21c1
Sequence:CCGGCTGAGAGAGAGCAAGCGTTTCCTCGAGGAAACGCTTGCTCTCTCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_020408.3-301s1c1
Sequence:CCGGCAGGAGGATAAGAGATGCCTTCTCGAGAAGGCATCTCTTATCCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020408.3-275s1c1
Sequence:CCGGGCCTACAATTACAGAACATATCTCGAGATATGTTCTGTAATTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020408.3-378s1c1
Sequence:CCGGCCAAGAGAGACCTTGGAGTAACTCGAGTTACTCCAAGGTCTCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_020408.3-445s1c1
Sequence:CCGGGATCATTGAGAATCGAGACATCTCGAGATGTCTCGATTCTCAATGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_020408.3-421s1c1
Sequence:CCGGCCAACTGTATTCAACTGACAACTCGAGTTGTCAGTTGAATACAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020408
VALIDATED
LYRM4 MISSION shRNA Lentiviral Transduction Particles
LYR motif containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-337s21c1
Sequence:CCGGTGTAAAGGATCCTGTAGAAATCTCGAGATTTCTACAGGATCCTTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-445s21c1
Sequence:CCGGGATCATTGAGAATCGAGACATCTCGAGATGTCTCGATTCTCAATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-761s21c1
Sequence:CCGGGACCATTGTGTATAGCATTTCCTCGAGGAAATGCTATACACAATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-275s21c1
Sequence:CCGGGCCTACAATTACAGAACATATCTCGAGATATGTTCTGTAATTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_020408.3-251s21c1
Sequence:CCGGCTGAGAGAGAGCAAGCGTTTCCTCGAGGAAACGCTTGCTCTCTCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_020408.3-301s1c1
Sequence:CCGGCAGGAGGATAAGAGATGCCTTCTCGAGAAGGCATCTCTTATCCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020408.3-275s1c1
Sequence:CCGGGCCTACAATTACAGAACATATCTCGAGATATGTTCTGTAATTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020408.3-378s1c1
Sequence:CCGGCCAAGAGAGACCTTGGAGTAACTCGAGTTACTCCAAGGTCTCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_020408.3-445s1c1
Sequence:CCGGGATCATTGAGAATCGAGACATCTCGAGATGTCTCGATTCTCAATGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_020408.3-421s1c1
Sequence:CCGGCCAACTGTATTCAACTGACAACTCGAGTTGTCAGTTGAATACAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201358
VALIDATED
LYRM4 MISSION shRNA Bacterial Glycerol Stock
LYR motif containing 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201358.1-271s1c1
Sequence:CCGGCAGGAGAATAAGAGATGCCTTCTCGAGAAGGCATCTCTTATTCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201358.2-259s21c1
Sequence:CCGGAGCATTTCAGCGCCTACAATTCTCGAGAATTGTAGGCGCTGAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201358.2-1008s21c1
Sequence:CCGGCCGCCACTCAAACCTACAAATCTCGAGATTTGTAGGTTTGAGTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201358.2-453s21c1
Sequence:CCGGCAAGAGAAGCCCAGGACATAGCTCGAGCTATGTCCTGGGCTTCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201358.2-393s21c1
Sequence:CCGGATCCGCAGACAGGTCCATATTCTCGAGAATATGGACCTGTCTGCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201358.1-391s1c1
Sequence:CCGGCCAACTATACTCAACTGACAACTCGAGTTGTCAGTTGAGTATAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201358.2-422s21c1
Sequence:CCGGATACTCAACTGACAAGCTTATCTCGAGATAAGCTTGTCAGTTGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201358
VALIDATED
LYRM4 MISSION shRNA shRNA Plasmid DNA
LYR motif containing 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201358.1-271s1c1
Sequence:CCGGCAGGAGAATAAGAGATGCCTTCTCGAGAAGGCATCTCTTATTCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201358.2-259s21c1
Sequence:CCGGAGCATTTCAGCGCCTACAATTCTCGAGAATTGTAGGCGCTGAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201358.2-1008s21c1
Sequence:CCGGCCGCCACTCAAACCTACAAATCTCGAGATTTGTAGGTTTGAGTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201358.2-453s21c1
Sequence:CCGGCAAGAGAAGCCCAGGACATAGCTCGAGCTATGTCCTGGGCTTCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201358.2-393s21c1
Sequence:CCGGATCCGCAGACAGGTCCATATTCTCGAGAATATGGACCTGTCTGCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201358.1-391s1c1
Sequence:CCGGCCAACTATACTCAACTGACAACTCGAGTTGTCAGTTGAGTATAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201358.2-422s21c1
Sequence:CCGGATACTCAACTGACAAGCTTATCTCGAGATAAGCTTGTCAGTTGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201358
VALIDATED
LYRM4 MISSION shRNA Lentiviral Transduction Particles
LYR motif containing 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201358.1-271s1c1
Sequence:CCGGCAGGAGAATAAGAGATGCCTTCTCGAGAAGGCATCTCTTATTCTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201358.2-259s21c1
Sequence:CCGGAGCATTTCAGCGCCTACAATTCTCGAGAATTGTAGGCGCTGAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201358.2-1008s21c1
Sequence:CCGGCCGCCACTCAAACCTACAAATCTCGAGATTTGTAGGTTTGAGTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201358.2-453s21c1
Sequence:CCGGCAAGAGAAGCCCAGGACATAGCTCGAGCTATGTCCTGGGCTTCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201358.2-393s21c1
Sequence:CCGGATCCGCAGACAGGTCCATATTCTCGAGAATATGGACCTGTCTGCGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201358.1-391s1c1
Sequence:CCGGCCAACTATACTCAACTGACAACTCGAGTTGTCAGTTGAGTATAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201358.2-422s21c1
Sequence:CCGGATACTCAACTGACAAGCTTATCTCGAGATAAGCTTGTCAGTTGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)