EMAIL THIS PAGE TO A FRIEND

LYRM5

LYR motif containing 5

45 Gene Product Result for
UniProtKB ID: Q6IPR1, J3KPI7
Gene ID:
Mouse(67636) LYR motif containing 5
Rat(100361188) LYR motif containing 5
chicken(776112) LYR motif containing 5
cow(783110) LYR motif containing 5
domestic cat(101097652) LYR motif containing 5
dog(477669) LYR motif containing 5
naked mole-rat(101720172) LYR motif containing 5
domestic guinea pig(100715982) LYR motif containing 5
sheep(101114600) LYR motif containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001660 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126711 MISSION® esiRNA esiRNA human LYRM5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001660 Rosetta Predictions human pricing
NM_133688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209567 predicted 376
2 SASI_Hs01_00209570 predicted 451
3 SASI_Hs02_00303855 predicted 205
4 SASI_Hs01_00209571 predicted 388
5 SASI_Hs01_00209572 predicted 704
6 SASI_Hs01_00209573 predicted 688
7 SASI_Hs01_00209574 predicted 419
8 SASI_Hs01_00209575 predicted 550
9 SASI_Hs02_00303856 predicted 464
10 SASI_Hs02_00303857 predicted 695
11 SASI_Hs01_00209566 predicted 299
12 SASI_Hs01_00209568 predicted 294
13 SASI_Hs01_00209569 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092106 predicted 368
2 SASI_Mm01_00092107 predicted 314
3 SASI_Mm01_00092108 predicted 343
4 SASI_Mm01_00092109 predicted 258
5 SASI_Mm01_00092110 predicted 571
6 SASI_Mm01_00092111 predicted 356
7 SASI_Mm01_00092112 predicted 672
8 SASI_Mm01_00092113 predicted 760
9 SASI_Mm01_00092114 predicted 347
10 SASI_Mm01_00092115 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133688
LYRM5 MISSION shRNA Bacterial Glycerol Stock
LYR motif containing 5
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133688.1-1821s1c1
Sequence:CCGGGCTGCAAATAGTGTTGCTTATCTCGAGATAAGCAACACTATTTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133688.1-1907s1c1
Sequence:CCGGCCTGAATTTAATTCCCAGCAACTCGAGTTGCTGGGAATTAAATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-852s1c1
Sequence:CCGGCTGTATCTTGGACGGGACTATCTCGAGATAGTCCCGTCCAAGATACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-1038s1c1
Sequence:CCGGCGTTACTATTCAGATACCAAACTCGAGTTTGGTATCTGAATAGTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-975s1c1
Sequence:CCGGGAATTTGTAATGAAGGAGCTACTCGAGTAGCTCCTTCATTACAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-1000s1c1
Sequence:CCGGCCTTGTACTTCCTTAGGAAATCTCGAGATTTCCTAAGGAAGTACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-1026s1c1
Sequence:CCGGGCTATGAAGCAACGTTACTATCTCGAGATAGTAACGTTGCTTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133688.1-1946s1c1
Sequence:CCGGCCATCTGTAATGGGATCTGATCTCGAGATCAGATCCCATTACAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133688.2-373s21c1
Sequence:CCGGCCAAAGTCTGACCAATCATTGCTCGAGCAATGATTGGTCAGACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133688.2-346s21c1
Sequence:CCGGCTATGAAGCAACGTTACTATTCTCGAGAATAGTAACGTTGCTTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133688.2-172s21c1
Sequence:CCGGTGTATCTTGGACGGGACTATCCTCGAGGATAGTCCCGTCCAAGATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133688.2-887s21c1
Sequence:CCGGCTAGCATTGTGTAGCTATTATCTCGAGATAATAGCTACACAATGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133688.2-264s21c1
Sequence:CCGGGAGAAGATCAAAGAACTTATCCTCGAGGATAAGTTCTTTGATCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133688
LYRM5 MISSION shRNA shRNA Plasmid DNA
LYR motif containing 5
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133688.1-1821s1c1
Sequence:CCGGGCTGCAAATAGTGTTGCTTATCTCGAGATAAGCAACACTATTTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133688.1-1907s1c1
Sequence:CCGGCCTGAATTTAATTCCCAGCAACTCGAGTTGCTGGGAATTAAATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-852s1c1
Sequence:CCGGCTGTATCTTGGACGGGACTATCTCGAGATAGTCCCGTCCAAGATACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-1038s1c1
Sequence:CCGGCGTTACTATTCAGATACCAAACTCGAGTTTGGTATCTGAATAGTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-975s1c1
Sequence:CCGGGAATTTGTAATGAAGGAGCTACTCGAGTAGCTCCTTCATTACAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-1000s1c1
Sequence:CCGGCCTTGTACTTCCTTAGGAAATCTCGAGATTTCCTAAGGAAGTACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-1026s1c1
Sequence:CCGGGCTATGAAGCAACGTTACTATCTCGAGATAGTAACGTTGCTTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133688.1-1946s1c1
Sequence:CCGGCCATCTGTAATGGGATCTGATCTCGAGATCAGATCCCATTACAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133688.2-373s21c1
Sequence:CCGGCCAAAGTCTGACCAATCATTGCTCGAGCAATGATTGGTCAGACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133688.2-346s21c1
Sequence:CCGGCTATGAAGCAACGTTACTATTCTCGAGAATAGTAACGTTGCTTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133688.2-172s21c1
Sequence:CCGGTGTATCTTGGACGGGACTATCCTCGAGGATAGTCCCGTCCAAGATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133688.2-887s21c1
Sequence:CCGGCTAGCATTGTGTAGCTATTATCTCGAGATAATAGCTACACAATGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133688.2-264s21c1
Sequence:CCGGGAGAAGATCAAAGAACTTATCCTCGAGGATAAGTTCTTTGATCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133688
LYRM5 MISSION shRNA Lentiviral Transduction Particles
LYR motif containing 5
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133688.1-1821s1c1
Sequence:CCGGGCTGCAAATAGTGTTGCTTATCTCGAGATAAGCAACACTATTTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197554    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133688.1-1907s1c1
Sequence:CCGGCCTGAATTTAATTCCCAGCAACTCGAGTTGCTGGGAATTAAATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-852s1c1
Sequence:CCGGCTGTATCTTGGACGGGACTATCTCGAGATAGTCCCGTCCAAGATACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-1038s1c1
Sequence:CCGGCGTTACTATTCAGATACCAAACTCGAGTTTGGTATCTGAATAGTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-975s1c1
Sequence:CCGGGAATTTGTAATGAAGGAGCTACTCGAGTAGCTCCTTCATTACAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-1000s1c1
Sequence:CCGGCCTTGTACTTCCTTAGGAAATCTCGAGATTTCCTAAGGAAGTACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133688.1-1026s1c1
Sequence:CCGGGCTATGAAGCAACGTTACTATCTCGAGATAGTAACGTTGCTTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177680    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133688.1-1946s1c1
Sequence:CCGGCCATCTGTAATGGGATCTGATCTCGAGATCAGATCCCATTACAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133688.2-373s21c1
Sequence:CCGGCCAAAGTCTGACCAATCATTGCTCGAGCAATGATTGGTCAGACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133688.2-346s21c1
Sequence:CCGGCTATGAAGCAACGTTACTATTCTCGAGAATAGTAACGTTGCTTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133688.2-172s21c1
Sequence:CCGGTGTATCTTGGACGGGACTATCCTCGAGGATAGTCCCGTCCAAGATACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133688.2-887s21c1
Sequence:CCGGCTAGCATTGTGTAGCTATTATCTCGAGATAATAGCTACACAATGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133688.2-264s21c1
Sequence:CCGGGAGAAGATCAAAGAACTTATCCTCGAGGATAAGTTCTTTGATCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001660
LYRM5 MISSION shRNA Bacterial Glycerol Stock
LYR motif containing 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001660.1-637s1c1
Sequence:CCGGCCTCTAACTTAATAGGACTTACTCGAGTAAGTCCTATTAAGTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001660.1-322s1c1
Sequence:CCGGGCTATGAAACAACGCTATTATCTCGAGATAATAGCGTTGTTTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001660.1-295s1c1
Sequence:CCGGGCTTTGTACTTCCTTAGGAAACTCGAGTTTCCTAAGGAAGTACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001660.1-306s1c1
Sequence:CCGGCCTTAGGAAATACAGAGCTATCTCGAGATAGCTCTGTATTTCCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001660.1-147s1c1
Sequence:CCGGGCTGTATCTTGGACGAGACTACTCGAGTAGTCTCGTCCAAGATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001660.2-322s21c1
Sequence:CCGGCTTATTGCACAGGGCGAATTTCTCGAGAAATTCGCCCTGTGCAATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001660.2-638s21c1
Sequence:CCGGTAGCTATACTACCGATCATAACTCGAGTTATGATCGGTAGTATAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001660
LYRM5 MISSION shRNA shRNA Plasmid DNA
LYR motif containing 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001660.1-637s1c1
Sequence:CCGGCCTCTAACTTAATAGGACTTACTCGAGTAAGTCCTATTAAGTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001660.1-322s1c1
Sequence:CCGGGCTATGAAACAACGCTATTATCTCGAGATAATAGCGTTGTTTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001660.1-295s1c1
Sequence:CCGGGCTTTGTACTTCCTTAGGAAACTCGAGTTTCCTAAGGAAGTACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001660.1-306s1c1
Sequence:CCGGCCTTAGGAAATACAGAGCTATCTCGAGATAGCTCTGTATTTCCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001660.1-147s1c1
Sequence:CCGGGCTGTATCTTGGACGAGACTACTCGAGTAGTCTCGTCCAAGATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001660.2-322s21c1
Sequence:CCGGCTTATTGCACAGGGCGAATTTCTCGAGAAATTCGCCCTGTGCAATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001660.2-638s21c1
Sequence:CCGGTAGCTATACTACCGATCATAACTCGAGTTATGATCGGTAGTATAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001660
LYRM5 MISSION shRNA Lentiviral Transduction Particles
LYR motif containing 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001660.1-637s1c1
Sequence:CCGGCCTCTAACTTAATAGGACTTACTCGAGTAAGTCCTATTAAGTTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001660.1-322s1c1
Sequence:CCGGGCTATGAAACAACGCTATTATCTCGAGATAATAGCGTTGTTTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001660.1-295s1c1
Sequence:CCGGGCTTTGTACTTCCTTAGGAAACTCGAGTTTCCTAAGGAAGTACAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001660.1-306s1c1
Sequence:CCGGCCTTAGGAAATACAGAGCTATCTCGAGATAGCTCTGTATTTCCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001660.1-147s1c1
Sequence:CCGGGCTGTATCTTGGACGAGACTACTCGAGTAGTCTCGTCCAAGATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001660.2-322s21c1
Sequence:CCGGCTTATTGCACAGGGCGAATTTCTCGAGAAATTCGCCCTGTGCAATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001660.2-638s21c1
Sequence:CCGGTAGCTATACTACCGATCATAACTCGAGTTATGATCGGTAGTATAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)