EMAIL THIS PAGE TO A FRIEND

LYRM7

LYR motif containing 7

86 Gene Product Result for
Synonyms: C5orf31 MZM1L
UniProtKB ID: Q5U5X0, A8MPQ9, Q86Y68
Gene ID:
Mouse(75530) LYR motif containing 7
Rat(686506) LYR motif containing 7
chicken(768932) Lyrm7 homolog (mouse)
cow(618451) Lyrm7 homolog (mouse)
domestic cat(101083395) LYR motif containing 7
dog(609480) LYR motif containing 7
sheep(101103807) LYR motif containing 7
domestic guinea pig(100716972) LYR motif containing 7
naked mole-rat(101700105) LYR motif containing 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA050053 Anti-LYRM7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181705 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029327 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029327 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029327 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181705 Rosetta Predictions human pricing
NM_001134729 Rosetta Predictions rat pricing
NM_029327 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246591 predicted 535
2 SASI_Hs01_00246592 predicted 245
3 SASI_Hs01_00246594 predicted 261
4 SASI_Hs01_00246595 predicted 329
5 SASI_Hs02_00370308 predicted 204
6 SASI_Hs02_00370309 predicted 543
7 SASI_Hs01_00246596 predicted 634
8 SASI_Hs01_00246597 predicted 655
9 SASI_Hs01_00246598 predicted 275
10 SASI_Hs01_00246599 predicted 553
11 SASI_Hs01_00246590 predicted 318
12 SASI_Hs01_00246593 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134729 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258204 predicted 794
2 SASI_Rn02_00258205 predicted 504
3 SASI_Rn02_00258206 predicted 791
4 SASI_Rn02_00258207 predicted 209
5 SASI_Rn02_00258208 predicted 242
6 SASI_Rn02_00258209 predicted 768
7 SASI_Rn02_00258210 predicted 404
8 SASI_Rn02_00258211 predicted 386
9 SASI_Rn02_00258212 predicted 748
10 SASI_Rn02_00258213 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335139 predicted 522
2 SASI_Mm02_00335140 predicted 520
3 SASI_Mm02_00335141 predicted 773
4 SASI_Mm01_00095308 predicted 216
5 SASI_Mm02_00335142 predicted 580
6 SASI_Mm02_00335143 predicted 610
7 SASI_Mm02_00335144 predicted 199
8 SASI_Mm02_00335145 predicted 387
9 SASI_Mm02_00335146 predicted 226
10 SASI_Mm02_00335147 predicted 553
11 SASI_Mm01_00095301 predicted 883
12 SASI_Mm01_00095302 predicted 448
13 SASI_Mm01_00095303 predicted 1084
14 SASI_Mm01_00095304 predicted 792
15 SASI_Mm01_00095305 predicted 1128
16 SASI_Mm01_00095306 predicted 747
17 SASI_Mm01_00095307 predicted 1028
18 SASI_Mm01_00095309 predicted 513
19 SASI_Mm01_00095310 predicted 1043
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181705
VALIDATED
LYRM7 MISSION shRNA Bacterial Glycerol Stock
LYR motif containing 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181705.2-641s21c1
Sequence:CCGGTAAATGCTTAGGGAGATATATCTCGAGATATATCTCCCTAAGCATTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181705.2-539s21c1
Sequence:CCGGAGGTCATTACTGAGAACTAAACTCGAGTTTAGTTCTCAGTAATGACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181705.2-395s21c1
Sequence:CCCGTAGAATACAACAAGTCTTTGTCTCGAGACAAAGACTTGTTGTATTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181705.2-498s21c1
Sequence:CCGGATGAATTACAGAATAGCTTCACTCGAGTGAAGCTATTCTGTAATTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-128s1c1
Sequence:CCGGGCAGCCAGAATAAAGATAAATCTCGAGATTTATCTTTATTCTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-263s1c1
Sequence:CCGGACAGACCACAATACACTGAAACTCGAGTTTCAGTGTATTGTGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-318s1c1
Sequence:CCGGTGCCATATTGTGATGCACCAACTCGAGTTGGTGCATCACAATATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-253s1c1
Sequence:CCGGAGGTATTCACACAGACCACAACTCGAGTTGTGGTCTGTGTGAATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-81s1c1
Sequence:CCGGACAGGACCAGACAACAAGTTTCTCGAGAAACTTGTTGTCTGGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181705
VALIDATED
LYRM7 MISSION shRNA shRNA Plasmid DNA
LYR motif containing 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181705.2-641s21c1
Sequence:CCGGTAAATGCTTAGGGAGATATATCTCGAGATATATCTCCCTAAGCATTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181705.2-539s21c1
Sequence:CCGGAGGTCATTACTGAGAACTAAACTCGAGTTTAGTTCTCAGTAATGACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181705.2-395s21c1
Sequence:CCCGTAGAATACAACAAGTCTTTGTCTCGAGACAAAGACTTGTTGTATTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181705.2-498s21c1
Sequence:CCGGATGAATTACAGAATAGCTTCACTCGAGTGAAGCTATTCTGTAATTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-128s1c1
Sequence:CCGGGCAGCCAGAATAAAGATAAATCTCGAGATTTATCTTTATTCTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-263s1c1
Sequence:CCGGACAGACCACAATACACTGAAACTCGAGTTTCAGTGTATTGTGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-318s1c1
Sequence:CCGGTGCCATATTGTGATGCACCAACTCGAGTTGGTGCATCACAATATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-253s1c1
Sequence:CCGGAGGTATTCACACAGACCACAACTCGAGTTGTGGTCTGTGTGAATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-81s1c1
Sequence:CCGGACAGGACCAGACAACAAGTTTCTCGAGAAACTTGTTGTCTGGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181705
VALIDATED
LYRM7 MISSION shRNA Lentiviral Transduction Particles
LYR motif containing 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181705.2-641s21c1
Sequence:CCGGTAAATGCTTAGGGAGATATATCTCGAGATATATCTCCCTAAGCATTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181705.2-539s21c1
Sequence:CCGGAGGTCATTACTGAGAACTAAACTCGAGTTTAGTTCTCAGTAATGACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181705.2-395s21c1
Sequence:CCCGTAGAATACAACAAGTCTTTGTCTCGAGACAAAGACTTGTTGTATTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181705.2-498s21c1
Sequence:CCGGATGAATTACAGAATAGCTTCACTCGAGTGAAGCTATTCTGTAATTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-128s1c1
Sequence:CCGGGCAGCCAGAATAAAGATAAATCTCGAGATTTATCTTTATTCTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-263s1c1
Sequence:CCGGACAGACCACAATACACTGAAACTCGAGTTTCAGTGTATTGTGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-318s1c1
Sequence:CCGGTGCCATATTGTGATGCACCAACTCGAGTTGGTGCATCACAATATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-253s1c1
Sequence:CCGGAGGTATTCACACAGACCACAACTCGAGTTGTGGTCTGTGTGAATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_181705.1-81s1c1
Sequence:CCGGACAGGACCAGACAACAAGTTTCTCGAGAAACTTGTTGTCTGGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029327
LYRM7 MISSION shRNA Bacterial Glycerol Stock
LYR motif containing 7
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029327.3-1865s21c1
Sequence:CCGGCAGTCCCTCAACCCAACTTTACTCGAGTAAAGTTGGGTTGAGGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029327.3-197s21c1
Sequence:CCGGGGTTCTGATGTGGAATTATTGCTCGAGCAATAATTCCACATCAGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029327.3-219s21c1
Sequence:CCGGTCAGAACAGCTGTTATTCAAGCTCGAGCTTGAATAACAGCTGTTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029327.3-318s21c1
Sequence:CCGGCGCCAACCCAGAAGCAGTAAACTCGAGTTTACTGCTTCTGGGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029327.1-535s1c1
Sequence:CCGGGAATTATTGCTCAGAACAGCTCTCGAGAGCTGTTCTGAGCAATAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029327.1-439s1c1
Sequence:CCGGGCAGCCAGAGTAAAGATAAATCTCGAGATTTATCTTTACTCTGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029327
LYRM7 MISSION shRNA shRNA Plasmid DNA
LYR motif containing 7
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029327.3-1865s21c1
Sequence:CCGGCAGTCCCTCAACCCAACTTTACTCGAGTAAAGTTGGGTTGAGGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029327.3-197s21c1
Sequence:CCGGGGTTCTGATGTGGAATTATTGCTCGAGCAATAATTCCACATCAGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029327.3-219s21c1
Sequence:CCGGTCAGAACAGCTGTTATTCAAGCTCGAGCTTGAATAACAGCTGTTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029327.3-318s21c1
Sequence:CCGGCGCCAACCCAGAAGCAGTAAACTCGAGTTTACTGCTTCTGGGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029327.1-535s1c1
Sequence:CCGGGAATTATTGCTCAGAACAGCTCTCGAGAGCTGTTCTGAGCAATAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029327.1-439s1c1
Sequence:CCGGGCAGCCAGAGTAAAGATAAATCTCGAGATTTATCTTTACTCTGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029327
LYRM7 MISSION shRNA Lentiviral Transduction Particles
LYR motif containing 7
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029327.3-1865s21c1
Sequence:CCGGCAGTCCCTCAACCCAACTTTACTCGAGTAAAGTTGGGTTGAGGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029327.3-197s21c1
Sequence:CCGGGGTTCTGATGTGGAATTATTGCTCGAGCAATAATTCCACATCAGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029327.3-219s21c1
Sequence:CCGGTCAGAACAGCTGTTATTCAAGCTCGAGCTTGAATAACAGCTGTTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029327.3-318s21c1
Sequence:CCGGCGCCAACCCAGAAGCAGTAAACTCGAGTTTACTGCTTCTGGGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029327.1-535s1c1
Sequence:CCGGGAATTATTGCTCAGAACAGCTCTCGAGAGCTGTTCTGAGCAATAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029327.1-439s1c1
Sequence:CCGGGCAGCCAGAGTAAAGATAAATCTCGAGATTTATCTTTACTCTGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)