EMAIL THIS PAGE TO A FRIEND

LYRM9

LYR motif containing 9

81 Gene Product Result for
Synonyms: C17orf108
UniProtKB ID: A8MSI8, A6NJT7, Q6X7B8
Gene ID:
Mouse(66274) LYR motif containing 9
Rat(497962) LYR motif containing 9
naked mole-rat(101700221) LYR motif containing 9
domestic guinea pig(100729355) LYR motif containing 9
sheep(101102823) LYR motif containing 9
Zebrafish(563525) LYR motif containing 9
cow(615250) LYR motif containing 9
domestic cat(101086764) LYR motif containing 9
dog(610463) LYR motif containing 9
chicken(101750365) LYR motif containing 9
chicken(101668623) LYR motif containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001076681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001076681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001076681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001076680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001076680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001076680 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076680 Rosetta Predictions human pricing
XM_375430 Rosetta Predictions human pricing
XM_934752 Rosetta Predictions human pricing
XM_001080895 Rosetta Predictions rat pricing
XM_579762 Rosetta Predictions rat pricing
NM_001076681 Rosetta Predictions mouse pricing
XM_358407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311974 predicted 241
2 SASI_Hs02_00311975 predicted 286
3 SASI_Hs02_00311976 predicted 239
4 SASI_Hs02_00311977 predicted 210
5 SASI_Hs02_00311978 predicted 275
6 SASI_Hs02_00311979 predicted 291
7 SASI_Hs02_00311980 predicted 236
8 SASI_Hs02_00311981 predicted 407
9 SASI_Hs02_00311982 predicted 773
10 SASI_Hs02_00311983 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_375430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00275778 predicted 538
2 SASI_Hs01_00275779 predicted 573
3 SASI_Hs01_00275780 predicted 480
4 SASI_Hs01_00275781 predicted 453
5 SASI_Hs01_00275782 predicted 571
6 SASI_Hs01_00275783 predicted 412
7 SASI_Hs01_00275784 predicted 1065
8 SASI_Hs01_00275785 predicted 765
9 SASI_Hs01_00275786 predicted 577
10 SASI_Hs01_00275787 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291933 predicted 796
2 SASI_Hs01_00291934 predicted 841
3 SASI_Hs01_00291935 predicted 748
4 SASI_Hs01_00291936 predicted 717
5 SASI_Hs01_00291937 predicted 838
6 SASI_Hs01_00291938 predicted 676
7 SASI_Hs01_00291939 predicted 1328
8 SASI_Hs01_00291940 predicted 1038
9 SASI_Hs01_00291941 predicted 842
10 SASI_Hs01_00291942 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369750 predicted 195
2 SASI_Rn02_00369751 predicted 346
3 SASI_Rn02_00369752 predicted 385
4 SASI_Rn02_00369753 predicted 345
5 SASI_Rn02_00369754 predicted 231
6 SASI_Rn02_00369755 predicted 388
7 SASI_Rn02_00369756 predicted 395
8 SASI_Rn02_00369757 predicted 223
9 SASI_Rn02_00369758 predicted 401
10 SASI_Rn02_00369759 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408656 predicted 344
2 SASI_Rn02_00408657 predicted 387
3 SASI_Rn02_00408658 predicted 341
4 SASI_Rn02_00408659 predicted 229
5 SASI_Rn02_00408660 predicted 383
6 SASI_Rn02_00408661 predicted 401
7 SASI_Rn02_00408662 predicted 228
8 SASI_Rn02_00408663 predicted 406
9 SASI_Rn02_00408664 predicted 375
10 SASI_Rn02_00408665 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292339 predicted 349
2 SASI_Mm02_00292340 predicted 644
3 SASI_Mm02_00292341 predicted 405
4 SASI_Mm02_00292342 predicted 339
5 SASI_Mm02_00292343 predicted 301
6 SASI_Mm02_00292344 predicted 720
7 SASI_Mm02_00292345 predicted 425
8 SASI_Mm02_00292346 predicted 388
9 SASI_Mm02_00292347 predicted 397
10 SASI_Mm02_00292348 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_358407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219894 predicted 81
2 SASI_Mm01_00219895 predicted 307
3 SASI_Mm01_00219896 predicted 214
4 SASI_Mm01_00219897 predicted 259
5 SASI_Mm01_00219898 predicted 94
6 SASI_Mm01_00219899 predicted 208
7 SASI_Mm01_00219900 predicted 103
8 SASI_Mm01_00219901 predicted 203
9 SASI_Mm01_00219902 predicted 153
10 SASI_Mm01_00219903 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001076681
LYRM9 MISSION shRNA Bacterial Glycerol Stock
LYR motif containing 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076681.2-257s21c1
Sequence:CCGGCCGACTGGATCATGAACAAATCTCGAGATTTGTTCATGATCCAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076681.2-101s21c1
Sequence:CCGGAGCTGTACCGTTACTTGTTACCTCGAGGTAACAAGTAACGGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076681.2-217s21c1
Sequence:CCGGGAGAGAATCCAGCAGATTATTCTCGAGAATAATCTGCTGGATTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001076681.2-4504s21c1
Sequence:CCGGAGAGCCTGGACAGGGTATTTACTCGAGTAAATACCCTGTCCAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076681.2-169s21c1
Sequence:CCGGCATGCTGTCAGGCAGAGTTTCCTCGAGGAAACTCTGCCTGACAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001076681
LYRM9 MISSION shRNA shRNA Plasmid DNA
LYR motif containing 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076681.2-257s21c1
Sequence:CCGGCCGACTGGATCATGAACAAATCTCGAGATTTGTTCATGATCCAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076681.2-101s21c1
Sequence:CCGGAGCTGTACCGTTACTTGTTACCTCGAGGTAACAAGTAACGGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076681.2-217s21c1
Sequence:CCGGGAGAGAATCCAGCAGATTATTCTCGAGAATAATCTGCTGGATTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001076681.2-4504s21c1
Sequence:CCGGAGAGCCTGGACAGGGTATTTACTCGAGTAAATACCCTGTCCAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076681.2-169s21c1
Sequence:CCGGCATGCTGTCAGGCAGAGTTTCCTCGAGGAAACTCTGCCTGACAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001076681
LYRM9 MISSION shRNA Lentiviral Transduction Particles
LYR motif containing 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076681.2-257s21c1
Sequence:CCGGCCGACTGGATCATGAACAAATCTCGAGATTTGTTCATGATCCAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076681.2-101s21c1
Sequence:CCGGAGCTGTACCGTTACTTGTTACCTCGAGGTAACAAGTAACGGTACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076681.2-217s21c1
Sequence:CCGGGAGAGAATCCAGCAGATTATTCTCGAGAATAATCTGCTGGATTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001076681.2-4504s21c1
Sequence:CCGGAGAGCCTGGACAGGGTATTTACTCGAGTAAATACCCTGTCCAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076681.2-169s21c1
Sequence:CCGGCATGCTGTCAGGCAGAGTTTCCTCGAGGAAACTCTGCCTGACAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001076680
LYRM9 MISSION shRNA Bacterial Glycerol Stock
LYR motif containing 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001076680.1-736s21c1
Sequence:CCGGTTGAATCCCAGATGCAATAAGCTCGAGCTTATTGCATCTGGGATTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076680.1-246s21c1
Sequence:CCGGAGAGAATCCAGCAGATTATTACTCGAGTAATAATCTGCTGGATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076680.1-196s21c1
Sequence:CCGGGCATGCTGTCAGGCAGAGTTTCTCGAGAAACTCTGCCTGACAGCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076680.1-124s21c1
Sequence:CCGGACTGCAGCTCTACCGATACTTCTCGAGAAGTATCGGTAGAGCTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076680.1-285s21c1
Sequence:CCGGCTGACTGGATCATGAACAAATCTCGAGATTTGTTCATGATCCAGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001076680
LYRM9 MISSION shRNA shRNA Plasmid DNA
LYR motif containing 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001076680.1-736s21c1
Sequence:CCGGTTGAATCCCAGATGCAATAAGCTCGAGCTTATTGCATCTGGGATTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076680.1-246s21c1
Sequence:CCGGAGAGAATCCAGCAGATTATTACTCGAGTAATAATCTGCTGGATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076680.1-196s21c1
Sequence:CCGGGCATGCTGTCAGGCAGAGTTTCTCGAGAAACTCTGCCTGACAGCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076680.1-124s21c1
Sequence:CCGGACTGCAGCTCTACCGATACTTCTCGAGAAGTATCGGTAGAGCTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076680.1-285s21c1
Sequence:CCGGCTGACTGGATCATGAACAAATCTCGAGATTTGTTCATGATCCAGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001076680
LYRM9 MISSION shRNA Lentiviral Transduction Particles
LYR motif containing 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001076680.1-736s21c1
Sequence:CCGGTTGAATCCCAGATGCAATAAGCTCGAGCTTATTGCATCTGGGATTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076680.1-246s21c1
Sequence:CCGGAGAGAATCCAGCAGATTATTACTCGAGTAATAATCTGCTGGATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076680.1-196s21c1
Sequence:CCGGGCATGCTGTCAGGCAGAGTTTCTCGAGAAACTCTGCCTGACAGCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076680.1-124s21c1
Sequence:CCGGACTGCAGCTCTACCGATACTTCTCGAGAAGTATCGGTAGAGCTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076680.1-285s21c1
Sequence:CCGGCTGACTGGATCATGAACAAATCTCGAGATTTGTTCATGATCCAGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)