EMAIL THIS PAGE TO A FRIEND

LYSMD1

LysM, putative peptidoglycan-binding, domain containing 1

88 Gene Product Result for
Synonyms: RP11-68I18.5
UniProtKB ID: Q96S90, B4DQA1, Q69YX9
Gene ID:
Mouse(217779) LysM, putative peptidoglycan-binding, domain containing 1
Rat(499671) LysM, putative peptidoglycan-binding, domain containing 1
Zebrafish(791996) LysM, putative peptidoglycan-binding, domain containing 1
cow(510653) LysM, putative peptidoglycan-binding, domain containing 1
domestic cat(101097007) LysM, putative peptidoglycan-binding, domain containing 1
dog(608985) LysM, putative peptidoglycan-binding, domain containing 1
sheep(101112613) LysM, putative peptidoglycan-binding, domain containing 1
domestic guinea pig(100733466) LysM, putative peptidoglycan-binding, domain containing 1
naked mole-rat(101705420) LysM, putative peptidoglycan-binding, domain containing 1
Domestic Rabbit(100328664) LysM, putative peptidoglycan-binding, domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_212551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_212551 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028134 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028134 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028134 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_212551 Rosetta Predictions human pricing
NM_001024302 Rosetta Predictions rat pricing
NM_028134 Rosetta Predictions mouse pricing
NM_153121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213699 predicted 1295
2 SASI_Hs01_00213700 predicted 1505
3 SASI_Hs01_00213701 predicted 1656
4 SASI_Hs01_00213702 predicted 1626
5 SASI_Hs01_00213703 predicted 1502
6 SASI_Hs01_00213704 predicted 807
7 SASI_Hs01_00213705 predicted 1060
8 SASI_Hs01_00213706 predicted 1623
9 SASI_Hs01_00213707 predicted 701
10 SASI_Hs02_00374229 predicted 1652
11 SASI_Hs01_00213698 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090753 predicted 1490
2 SASI_Rn01_00090754 predicted 958
3 SASI_Rn01_00090755 predicted 1141
4 SASI_Rn01_00090756 predicted 1458
5 SASI_Rn02_00202498 predicted 1620
6 SASI_Rn01_00090759 predicted 1487
7 SASI_Rn01_00090760 predicted 812
8 SASI_Rn02_00202499 predicted 584
9 SASI_Rn01_00090761 predicted 1353
10 SASI_Rn01_00090762 predicted 962
11 SASI_Rn01_00090757 predicted 1503
12 SASI_Rn01_00090758 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109546 predicted 1524
2 SASI_Mm01_00109547 predicted 1520
3 SASI_Mm01_00109548 predicted 1786
4 SASI_Mm01_00109549 predicted 809
5 SASI_Mm01_00109550 predicted 1623
6 SASI_Mm01_00109551 predicted 1459
7 SASI_Mm01_00109552 predicted 1710
8 SASI_Mm01_00109553 predicted 1120
9 SASI_Mm01_00109554 predicted 744
10 SASI_Mm01_00109555 predicted 1724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188189 predicted 1599
2 SASI_Mm01_00188190 predicted 1590
3 SASI_Mm01_00188191 predicted 1848
4 SASI_Mm01_00188192 predicted 873
5 SASI_Mm01_00188193 predicted 1688
6 SASI_Mm01_00188194 predicted 1527
7 SASI_Mm01_00188195 predicted 1778
8 SASI_Mm01_00188196 predicted 1193
9 SASI_Mm01_00188197 predicted 814
10 SASI_Mm01_00188198 predicted 1796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212551
VALIDATED
LYSMD1 MISSION shRNA Bacterial Glycerol Stock
LysM, putative peptidoglycan-binding, domain containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-1104s21c1
Sequence:CCGGTTTCCTTAAGAAGCTTGATTCCTCGAGGAATCAAGCTTCTTAAGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-1026s21c1
Sequence:CCGGAGGACGTGCCAATGGTGAAGTCTCGAGACTTCACCATTGGCACGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-982s21c1
Sequence:CCGGGTTTGGCCACACTCAACTGAGCTCGAGCTCAGTTGAGTGTGGCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-828s21c1
Sequence:CCGGTAAACGTGCAAACCGCCTTTACTCGAGTAAAGGCGGTTTGCACGTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-1221s21c1
Sequence:CCGGTTGGATGCAGCAACGAGCAGTCTCGAGACTGCTCGTTGCTGCATCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212551.4-1691s21c1
Sequence:CCGGGGTGCTAATATTGAAGTAATACTCGAGTATTACTTCAATATTAGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-748s21c1
Sequence:CCGGAGACGCCTGGAGCATCAGTTGCTCGAGCAACTGATGCTCCAGGCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-961s21c1
Sequence:CCGGGTACACCCAAGTAACAGTGAACTCGAGTTCACTGTTACTTGGGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212551.1-1600s1c1
Sequence:CCGGGCTCAGTCTTGACAAACCAATCTCGAGATTGGTTTGTCAAGACTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212551.1-510s1c1
Sequence:CCGGCAGAGACCTGTTCAATGGTTTCTCGAGAAACCATTGAACAGGTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212551.1-447s1c1
Sequence:CCGGCCTTTATACTAATGACTCCATCTCGAGATGGAGTCATTAGTATAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212551.1-897s1c1
Sequence:CCGGCCAGGAGGATGAAATCTTCAACTCGAGTTGAAGATTTCATCCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212551.1-541s1c1
Sequence:CCGGGAAGAGAAAGATGGAGAGGAACTCGAGTTCCTCTCCATCTTTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212551
VALIDATED
LYSMD1 MISSION shRNA shRNA Plasmid DNA
LysM, putative peptidoglycan-binding, domain containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-1104s21c1
Sequence:CCGGTTTCCTTAAGAAGCTTGATTCCTCGAGGAATCAAGCTTCTTAAGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-1026s21c1
Sequence:CCGGAGGACGTGCCAATGGTGAAGTCTCGAGACTTCACCATTGGCACGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-982s21c1
Sequence:CCGGGTTTGGCCACACTCAACTGAGCTCGAGCTCAGTTGAGTGTGGCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-828s21c1
Sequence:CCGGTAAACGTGCAAACCGCCTTTACTCGAGTAAAGGCGGTTTGCACGTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-1221s21c1
Sequence:CCGGTTGGATGCAGCAACGAGCAGTCTCGAGACTGCTCGTTGCTGCATCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212551.4-1691s21c1
Sequence:CCGGGGTGCTAATATTGAAGTAATACTCGAGTATTACTTCAATATTAGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-748s21c1
Sequence:CCGGAGACGCCTGGAGCATCAGTTGCTCGAGCAACTGATGCTCCAGGCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-961s21c1
Sequence:CCGGGTACACCCAAGTAACAGTGAACTCGAGTTCACTGTTACTTGGGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212551.1-1600s1c1
Sequence:CCGGGCTCAGTCTTGACAAACCAATCTCGAGATTGGTTTGTCAAGACTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212551.1-510s1c1
Sequence:CCGGCAGAGACCTGTTCAATGGTTTCTCGAGAAACCATTGAACAGGTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212551.1-447s1c1
Sequence:CCGGCCTTTATACTAATGACTCCATCTCGAGATGGAGTCATTAGTATAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212551.1-897s1c1
Sequence:CCGGCCAGGAGGATGAAATCTTCAACTCGAGTTGAAGATTTCATCCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212551.1-541s1c1
Sequence:CCGGGAAGAGAAAGATGGAGAGGAACTCGAGTTCCTCTCCATCTTTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212551
VALIDATED
LYSMD1 MISSION shRNA Lentiviral Transduction Particles
LysM, putative peptidoglycan-binding, domain containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-1104s21c1
Sequence:CCGGTTTCCTTAAGAAGCTTGATTCCTCGAGGAATCAAGCTTCTTAAGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-1026s21c1
Sequence:CCGGAGGACGTGCCAATGGTGAAGTCTCGAGACTTCACCATTGGCACGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-982s21c1
Sequence:CCGGGTTTGGCCACACTCAACTGAGCTCGAGCTCAGTTGAGTGTGGCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-828s21c1
Sequence:CCGGTAAACGTGCAAACCGCCTTTACTCGAGTAAAGGCGGTTTGCACGTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-1221s21c1
Sequence:CCGGTTGGATGCAGCAACGAGCAGTCTCGAGACTGCTCGTTGCTGCATCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_212551.4-1691s21c1
Sequence:CCGGGGTGCTAATATTGAAGTAATACTCGAGTATTACTTCAATATTAGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-748s21c1
Sequence:CCGGAGACGCCTGGAGCATCAGTTGCTCGAGCAACTGATGCTCCAGGCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_212551.4-961s21c1
Sequence:CCGGGTACACCCAAGTAACAGTGAACTCGAGTTCACTGTTACTTGGGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212551.1-1600s1c1
Sequence:CCGGGCTCAGTCTTGACAAACCAATCTCGAGATTGGTTTGTCAAGACTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212551.1-510s1c1
Sequence:CCGGCAGAGACCTGTTCAATGGTTTCTCGAGAAACCATTGAACAGGTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212551.1-447s1c1
Sequence:CCGGCCTTTATACTAATGACTCCATCTCGAGATGGAGTCATTAGTATAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_212551.1-897s1c1
Sequence:CCGGCCAGGAGGATGAAATCTTCAACTCGAGTTGAAGATTTCATCCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_212551.1-541s1c1
Sequence:CCGGGAAGAGAAAGATGGAGAGGAACTCGAGTTCCTCTCCATCTTTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028134
VALIDATED
LYSMD1 MISSION shRNA Bacterial Glycerol Stock
LysM, putative peptidoglycan-binding, domain containing 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028134.2-832s21c1
Sequence:CCGGTAAGCGTACAAACCGCCTTTACTCGAGTAAAGGCGGTTTGTACGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028134.2-1528s21c1
Sequence:CCGGAGTTAGCCTTTAGATTCAAAGCTCGAGCTTTGAATCTAAAGGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028134.2-752s21c1
Sequence:CCGGAGACGCCTGGAGCATCAATTGCTCGAGCAATTGATGCTCCAGGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028134.2-1288s21c1
Sequence:CCGGGCGGGACCAGGAAGATGAAATCTCGAGATTTCATCTTCCTGGTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028134.2-789s21c1
Sequence:CCGGTGGCTGGATTAGCACTCAAATCTCGAGATTTGAGTGCTAATCCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028134.1-2108s1c1
Sequence:CCGGCCACTTCATATGTATCTGTAACTCGAGTTACAGATACATATGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028134
VALIDATED
LYSMD1 MISSION shRNA shRNA Plasmid DNA
LysM, putative peptidoglycan-binding, domain containing 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028134.2-832s21c1
Sequence:CCGGTAAGCGTACAAACCGCCTTTACTCGAGTAAAGGCGGTTTGTACGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028134.2-1528s21c1
Sequence:CCGGAGTTAGCCTTTAGATTCAAAGCTCGAGCTTTGAATCTAAAGGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028134.2-752s21c1
Sequence:CCGGAGACGCCTGGAGCATCAATTGCTCGAGCAATTGATGCTCCAGGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028134.2-1288s21c1
Sequence:CCGGGCGGGACCAGGAAGATGAAATCTCGAGATTTCATCTTCCTGGTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028134.2-789s21c1
Sequence:CCGGTGGCTGGATTAGCACTCAAATCTCGAGATTTGAGTGCTAATCCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028134.1-2108s1c1
Sequence:CCGGCCACTTCATATGTATCTGTAACTCGAGTTACAGATACATATGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028134
VALIDATED
LYSMD1 MISSION shRNA Lentiviral Transduction Particles
LysM, putative peptidoglycan-binding, domain containing 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028134.2-832s21c1
Sequence:CCGGTAAGCGTACAAACCGCCTTTACTCGAGTAAAGGCGGTTTGTACGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028134.2-1528s21c1
Sequence:CCGGAGTTAGCCTTTAGATTCAAAGCTCGAGCTTTGAATCTAAAGGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028134.2-752s21c1
Sequence:CCGGAGACGCCTGGAGCATCAATTGCTCGAGCAATTGATGCTCCAGGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028134.2-1288s21c1
Sequence:CCGGGCGGGACCAGGAAGATGAAATCTCGAGATTTCATCTTCCTGGTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028134.2-789s21c1
Sequence:CCGGTGGCTGGATTAGCACTCAAATCTCGAGATTTGAGTGCTAATCCAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183756    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028134.1-2108s1c1
Sequence:CCGGCCACTTCATATGTATCTGTAACTCGAGTTACAGATACATATGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)