EMAIL THIS PAGE TO A FRIEND

LYSMD2

LysM, putative peptidoglycan-binding, domain containing 2

104 Gene Product Result for
UniProtKB ID: Q8IV50, Q5CZ88, Q8WTV3
Gene ID:
Mouse(70082) LysM, putative peptidoglycan-binding, domain containing 2
Rat(300839) LysM, putative peptidoglycan-binding, domain containing 2
naked mole-rat(101703634) LysM, putative peptidoglycan-binding, domain containing 2
domestic guinea pig(100718219) LysM, putative peptidoglycan-binding, domain containing 2
sheep(101107287) LysM, putative peptidoglycan-binding, domain containing 2
Zebrafish(445113) LysM, putative peptidoglycan-binding, domain containing 2
cow(511013) LysM, putative peptidoglycan-binding, domain containing 2
dog(478308) LysM, putative peptidoglycan-binding, domain containing 2
chicken(415423) LysM, putative peptidoglycan-binding, domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153374 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153374 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153374 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153374 Rosetta Predictions human pricing
NM_001106839 Rosetta Predictions rat pricing
NM_027309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074861 predicted 1200
2 SASI_Hs01_00074862 predicted 878
3 SASI_Hs01_00074863 predicted 792
4 SASI_Hs01_00074864 predicted 876
5 SASI_Hs01_00074866 predicted 1126
6 SASI_Hs01_00074867 predicted 826
7 SASI_Hs02_00367264 predicted 1113
8 SASI_Hs01_00074869 predicted 1009
9 SASI_Hs01_00074870 predicted 1121
10 SASI_Hs02_00367265 predicted 1176
11 SASI_Hs01_00074865 predicted 1029
12 SASI_Hs01_00074868 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222914 predicted 908
2 SASI_Rn02_00222915 predicted 382
3 SASI_Rn02_00222916 predicted 1008
4 SASI_Rn02_00222917 predicted 635
5 SASI_Rn02_00222918 predicted 455
6 SASI_Rn02_00222919 predicted 715
7 SASI_Rn02_00222920 predicted 830
8 SASI_Rn02_00222921 predicted 394
9 SASI_Rn02_00222922 predicted 837
10 SASI_Rn02_00222923 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331929 predicted 317
2 SASI_Mm01_00113864 predicted 577
3 SASI_Mm02_00331930 predicted 572
4 SASI_Mm01_00113865 predicted 797
5 SASI_Mm02_00331931 predicted 832
6 SASI_Mm02_00331932 predicted 826
7 SASI_Mm02_00331933 predicted 327
8 SASI_Mm02_00331934 predicted 264
9 SASI_Mm02_00331935 predicted 564
10 SASI_Mm02_00331936 predicted 416
11 SASI_Mm01_00113866 predicted 648
12 SASI_Mm01_00113867 predicted 321
13 SASI_Mm01_00113868 predicted 321
14 SASI_Mm01_00113869 predicted 266
15 SASI_Mm01_00113870 predicted 838
16 SASI_Mm01_00113871 predicted 687
17 SASI_Mm01_00113872 predicted 696
18 SASI_Mm01_00113873 predicted 880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153374
VALIDATED
LYSMD2 MISSION shRNA Bacterial Glycerol Stock
LysM, putative peptidoglycan-binding, domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153374.1-790s1c1
Sequence:CCGGGCCAATAAACTGTTTACCAATCTCGAGATTGGTAAACAGTTTATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153374.1-856s1c1
Sequence:CCGGGAGAAGCCTTTGTTGTTTAATCTCGAGATTAAACAACAAAGGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153374.1-1062s1c1
Sequence:CCGGGTTATCAACACAGGCAGCCAACTCGAGTTGGCTGCCTGTGTTGATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153374.1-1117s1c1
Sequence:CCGGCCCTATGCAACTTCCCTCTATCTCGAGATAGAGGGAAGTTGCATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153374.2-1355s21c1
Sequence:CCGGTGGCAAGGTTGTAGCCTAAAGCTCGAGCTTTAGGCTACAACCTTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153374.2-1486s21c1
Sequence:CCGGCCTTATGCAATCCTGATTATGCTCGAGCATAATCAGGATTGCATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153374.2-836s21c1
Sequence:CCGGCTTTGAACATCCCAGTTATATCTCGAGATATAACTGGGATGTTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153374.2-798s21c1
Sequence:CCGGTAAACTGTTTACCAATGATTGCTCGAGCAATCATTGGTAAACAGTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153374.2-1017s21c1
Sequence:CCGGGGAAGTGTCAGCCAGAGATTTCTCGAGAAATCTCTGGCTGACACTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153374.2-1043s21c1
Sequence:CCGGAGAGACTTGACTTGCAGATTACTCGAGTAATCTGCAAGTCAAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153374
VALIDATED
LYSMD2 MISSION shRNA shRNA Plasmid DNA
LysM, putative peptidoglycan-binding, domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153374.1-790s1c1
Sequence:CCGGGCCAATAAACTGTTTACCAATCTCGAGATTGGTAAACAGTTTATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153374.1-856s1c1
Sequence:CCGGGAGAAGCCTTTGTTGTTTAATCTCGAGATTAAACAACAAAGGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153374.1-1062s1c1
Sequence:CCGGGTTATCAACACAGGCAGCCAACTCGAGTTGGCTGCCTGTGTTGATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153374.1-1117s1c1
Sequence:CCGGCCCTATGCAACTTCCCTCTATCTCGAGATAGAGGGAAGTTGCATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153374.2-1355s21c1
Sequence:CCGGTGGCAAGGTTGTAGCCTAAAGCTCGAGCTTTAGGCTACAACCTTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153374.2-1486s21c1
Sequence:CCGGCCTTATGCAATCCTGATTATGCTCGAGCATAATCAGGATTGCATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153374.2-836s21c1
Sequence:CCGGCTTTGAACATCCCAGTTATATCTCGAGATATAACTGGGATGTTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153374.2-798s21c1
Sequence:CCGGTAAACTGTTTACCAATGATTGCTCGAGCAATCATTGGTAAACAGTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153374.2-1017s21c1
Sequence:CCGGGGAAGTGTCAGCCAGAGATTTCTCGAGAAATCTCTGGCTGACACTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153374.2-1043s21c1
Sequence:CCGGAGAGACTTGACTTGCAGATTACTCGAGTAATCTGCAAGTCAAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153374
VALIDATED
LYSMD2 MISSION shRNA Lentiviral Transduction Particles
LysM, putative peptidoglycan-binding, domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153374.1-790s1c1
Sequence:CCGGGCCAATAAACTGTTTACCAATCTCGAGATTGGTAAACAGTTTATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153374.1-856s1c1
Sequence:CCGGGAGAAGCCTTTGTTGTTTAATCTCGAGATTAAACAACAAAGGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153374.1-1062s1c1
Sequence:CCGGGTTATCAACACAGGCAGCCAACTCGAGTTGGCTGCCTGTGTTGATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153374.1-1117s1c1
Sequence:CCGGCCCTATGCAACTTCCCTCTATCTCGAGATAGAGGGAAGTTGCATAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153374.2-1355s21c1
Sequence:CCGGTGGCAAGGTTGTAGCCTAAAGCTCGAGCTTTAGGCTACAACCTTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153374.2-1486s21c1
Sequence:CCGGCCTTATGCAATCCTGATTATGCTCGAGCATAATCAGGATTGCATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153374.2-836s21c1
Sequence:CCGGCTTTGAACATCCCAGTTATATCTCGAGATATAACTGGGATGTTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153374.2-798s21c1
Sequence:CCGGTAAACTGTTTACCAATGATTGCTCGAGCAATCATTGGTAAACAGTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153374.2-1017s21c1
Sequence:CCGGGGAAGTGTCAGCCAGAGATTTCTCGAGAAATCTCTGGCTGACACTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_153374.2-1043s21c1
Sequence:CCGGAGAGACTTGACTTGCAGATTACTCGAGTAATCTGCAAGTCAAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027309
VALIDATED
LYSMD2 MISSION shRNA Bacterial Glycerol Stock
LysM, putative peptidoglycan-binding, domain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027309.1-616s1c1
Sequence:CCGGCAAAGAAGAGAGCAGGGATGACTCGAGTCATCCCTGCTCTCTTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027309.1-317s1c1
Sequence:CCGGGCCAACAAACTGTTTAACAATCTCGAGATTGTTAAACAGTTTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027309.1-1040s1c1
Sequence:CCGGGCATTTGCTGTGTGTTTATAACTCGAGTTATAAACACACAGCAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027309.1-568s1c1
Sequence:CCGGCAGACTGGACTTACAGATTAACTCGAGTTAATCTGTAAGTCCAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027309.1-650s1c1
Sequence:CCGGGCTGCCTCTCTTTATCATAGTCTCGAGACTATGATAAAGAGAGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027309.1-426s1c1
Sequence:CCGGCGGAAAGTGAAACTGTCGACACTCGAGTGTCGACAGTTTCACTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027309.1-390s1c1
Sequence:CCGGCCTTGCTGTTTAATGGACTTACTCGAGTAAGTCCATTAAACAGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027309.2-391s1c1
Sequence:CCGGGAGAAGCCTTTGCTGTTTAATCTCGAGATTAAACAGCAAAGGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027309
VALIDATED
LYSMD2 MISSION shRNA shRNA Plasmid DNA
LysM, putative peptidoglycan-binding, domain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027309.1-616s1c1
Sequence:CCGGCAAAGAAGAGAGCAGGGATGACTCGAGTCATCCCTGCTCTCTTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027309.1-317s1c1
Sequence:CCGGGCCAACAAACTGTTTAACAATCTCGAGATTGTTAAACAGTTTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027309.1-1040s1c1
Sequence:CCGGGCATTTGCTGTGTGTTTATAACTCGAGTTATAAACACACAGCAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027309.1-568s1c1
Sequence:CCGGCAGACTGGACTTACAGATTAACTCGAGTTAATCTGTAAGTCCAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027309.1-650s1c1
Sequence:CCGGGCTGCCTCTCTTTATCATAGTCTCGAGACTATGATAAAGAGAGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027309.1-426s1c1
Sequence:CCGGCGGAAAGTGAAACTGTCGACACTCGAGTGTCGACAGTTTCACTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027309.1-390s1c1
Sequence:CCGGCCTTGCTGTTTAATGGACTTACTCGAGTAAGTCCATTAAACAGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027309.2-391s1c1
Sequence:CCGGGAGAAGCCTTTGCTGTTTAATCTCGAGATTAAACAGCAAAGGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027309
VALIDATED
LYSMD2 MISSION shRNA Lentiviral Transduction Particles
LysM, putative peptidoglycan-binding, domain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027309.1-616s1c1
Sequence:CCGGCAAAGAAGAGAGCAGGGATGACTCGAGTCATCCCTGCTCTCTTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027309.1-317s1c1
Sequence:CCGGGCCAACAAACTGTTTAACAATCTCGAGATTGTTAAACAGTTTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177285    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027309.1-1040s1c1
Sequence:CCGGGCATTTGCTGTGTGTTTATAACTCGAGTTATAAACACACAGCAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027309.1-568s1c1
Sequence:CCGGCAGACTGGACTTACAGATTAACTCGAGTTAATCTGTAAGTCCAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027309.1-650s1c1
Sequence:CCGGGCTGCCTCTCTTTATCATAGTCTCGAGACTATGATAAAGAGAGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027309.1-426s1c1
Sequence:CCGGCGGAAAGTGAAACTGTCGACACTCGAGTGTCGACAGTTTCACTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027309.1-390s1c1
Sequence:CCGGCCTTGCTGTTTAATGGACTTACTCGAGTAAGTCCATTAAACAGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027309.2-391s1c1
Sequence:CCGGGAGAAGCCTTTGCTGTTTAATCTCGAGATTAAACAGCAAAGGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)