EMAIL THIS PAGE TO A FRIEND

LYSMD3

LysM, putative peptidoglycan-binding, domain containing 3

132 Gene Product Result for
UniProtKB ID: Q7Z3D4, Q5H9U0, Q6PEK0, Q9NTE9
Gene ID:
Mouse(80289) LysM, putative peptidoglycan-binding, domain containing 3
Rat(315923) LysM, putative peptidoglycan-binding, domain containing 3
Zebrafish(415194) LysM, putative peptidoglycan-binding, domain containing 3
chicken(427106) LysM, putative peptidoglycan-binding, domain containing 3
cow(613760) LysM, putative peptidoglycan-binding, domain containing 3
domestic cat(101099177) LysM, putative peptidoglycan-binding, domain containing 3
dog(488913) LysM, putative peptidoglycan-binding, domain containing 3
sheep(101106842) LysM, putative peptidoglycan-binding, domain containing 3
domestic guinea pig(100723416) LysM, putative peptidoglycan-binding, domain containing 3
naked mole-rat(101722030) LysM, putative peptidoglycan-binding, domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA018024 Anti-LYSMD3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198273 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU016501 MISSION® esiRNA esiRNA targeting mouse Lysmd3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198273 Rosetta Predictions human pricing
NM_001009698 Rosetta Predictions rat pricing
NM_030257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125316 predicted 401
2 SASI_Hs01_00125318 predicted 674
3 SASI_Hs01_00125320 predicted 1111
4 SASI_Hs01_00125321 predicted 814
5 SASI_Hs01_00125322 predicted 320
6 SASI_Hs01_00125323 predicted 392
7 SASI_Hs01_00125324 predicted 346
8 SASI_Hs01_00125325 predicted 310
9 SASI_Hs02_00371825 predicted 528
10 SASI_Hs02_00371826 predicted 910
11 SASI_Hs01_00125317 predicted 1066
12 SASI_Hs01_00125319 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076490 predicted 758
2 SASI_Rn01_00076491 predicted 425
3 SASI_Rn01_00076492 predicted 724
4 SASI_Rn01_00076493 predicted 668
5 SASI_Rn01_00076494 predicted 391
6 SASI_Rn01_00076495 predicted 347
7 SASI_Rn01_00076496 predicted 524
8 SASI_Rn01_00076497 predicted 926
9 SASI_Rn01_00076498 predicted 395
10 SASI_Rn02_00199758 predicted 513
11 SASI_Rn01_00076489 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082604 predicted 867
2 SASI_Mm01_00082605 predicted 993
3 SASI_Mm01_00082606 predicted 312
4 SASI_Mm01_00082608 predicted 817
5 SASI_Mm02_00336729 predicted 303
6 SASI_Mm01_00082609 predicted 284
7 SASI_Mm01_00082610 predicted 627
8 SASI_Mm01_00082611 predicted 1133
9 SASI_Mm01_00082612 predicted 707
10 SASI_Mm01_00082613 predicted 412
11 SASI_Mm01_00082607 predicted 1059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030257
VALIDATED
LYSMD3 MISSION shRNA Bacterial Glycerol Stock
LysM, putative peptidoglycan-binding, domain containing 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030257.1-997s21c1
Sequence:CCGGCAAGATGACCACAAACTATATCTCGAGATATAGTTTGTGGTCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030257.1-310s21c1
Sequence:CCGGGATAGACTTGATGACATTGTTCTCGAGAACAATGTCATCAAGTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030257.1-748s21c1
Sequence:CCGGCACCGAAAGGATCCGTATTACCTCGAGGTAATACGGATCCTTTCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030257.1-247s21c1
Sequence:CCGGGATGCTGAAGTCTACGAACTTCTCGAGAAGTTCGTAGACTTCAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030257.1-310s1c1
Sequence:CCGGGATAGACTTGATGACATTGTTCTCGAGAACAATGTCATCAAGTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030257.1-996s1c1
Sequence:CCGGGCAAGATGACCACAAACTATACTCGAGTATAGTTTGTGGTCATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030257.1-247s1c1
Sequence:CCGGGATGCTGAAGTCTACGAACTTCTCGAGAAGTTCGTAGACTTCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030257.1-997s1c1
Sequence:CCGGCAAGATGACCACAAACTATATCTCGAGATATAGTTTGTGGTCATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030257
VALIDATED
LYSMD3 MISSION shRNA shRNA Plasmid DNA
LysM, putative peptidoglycan-binding, domain containing 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030257.1-997s21c1
Sequence:CCGGCAAGATGACCACAAACTATATCTCGAGATATAGTTTGTGGTCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030257.1-310s21c1
Sequence:CCGGGATAGACTTGATGACATTGTTCTCGAGAACAATGTCATCAAGTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030257.1-748s21c1
Sequence:CCGGCACCGAAAGGATCCGTATTACCTCGAGGTAATACGGATCCTTTCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030257.1-247s21c1
Sequence:CCGGGATGCTGAAGTCTACGAACTTCTCGAGAAGTTCGTAGACTTCAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030257.1-310s1c1
Sequence:CCGGGATAGACTTGATGACATTGTTCTCGAGAACAATGTCATCAAGTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030257.1-996s1c1
Sequence:CCGGGCAAGATGACCACAAACTATACTCGAGTATAGTTTGTGGTCATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030257.1-247s1c1
Sequence:CCGGGATGCTGAAGTCTACGAACTTCTCGAGAAGTTCGTAGACTTCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030257.1-997s1c1
Sequence:CCGGCAAGATGACCACAAACTATATCTCGAGATATAGTTTGTGGTCATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030257
VALIDATED
LYSMD3 MISSION shRNA Lentiviral Transduction Particles
LysM, putative peptidoglycan-binding, domain containing 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030257.1-997s21c1
Sequence:CCGGCAAGATGACCACAAACTATATCTCGAGATATAGTTTGTGGTCATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030257.1-310s21c1
Sequence:CCGGGATAGACTTGATGACATTGTTCTCGAGAACAATGTCATCAAGTCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030257.1-748s21c1
Sequence:CCGGCACCGAAAGGATCCGTATTACCTCGAGGTAATACGGATCCTTTCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030257.1-247s21c1
Sequence:CCGGGATGCTGAAGTCTACGAACTTCTCGAGAAGTTCGTAGACTTCAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030257.1-310s1c1
Sequence:CCGGGATAGACTTGATGACATTGTTCTCGAGAACAATGTCATCAAGTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030257.1-996s1c1
Sequence:CCGGGCAAGATGACCACAAACTATACTCGAGTATAGTTTGTGGTCATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030257.1-247s1c1
Sequence:CCGGGATGCTGAAGTCTACGAACTTCTCGAGAAGTTCGTAGACTTCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030257.1-997s1c1
Sequence:CCGGCAAGATGACCACAAACTATATCTCGAGATATAGTTTGTGGTCATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198273
VALIDATED
LYSMD3 MISSION shRNA Bacterial Glycerol Stock
LysM, putative peptidoglycan-binding, domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198273.1-688s21c1
Sequence:CCGGGAACCTCAATGAGGTAGTATCCTCGAGGATACTACCTCATTGAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198273.1-1000s21c1
Sequence:CCGGCAGCCAACAAGATGATCATAACTCGAGTTATGATCATCTTGTTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198273.1-2027s21c1
Sequence:CCGGATTCGTTACATAGGCTATATACTCGAGTATATAGCCTATGTAACGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198273.1-323s21c1
Sequence:CCGGCTTGACGACATTATAGTATTACTCGAGTAATACTATAATGTCGTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198273.1-1064s21c1
Sequence:CCGGACATAGCAATTAGCTCATAATCTCGAGATTATGAGCTAATTGCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198273
VALIDATED
LYSMD3 MISSION shRNA shRNA Plasmid DNA
LysM, putative peptidoglycan-binding, domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198273.1-688s21c1
Sequence:CCGGGAACCTCAATGAGGTAGTATCCTCGAGGATACTACCTCATTGAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198273.1-1000s21c1
Sequence:CCGGCAGCCAACAAGATGATCATAACTCGAGTTATGATCATCTTGTTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198273.1-2027s21c1
Sequence:CCGGATTCGTTACATAGGCTATATACTCGAGTATATAGCCTATGTAACGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198273.1-323s21c1
Sequence:CCGGCTTGACGACATTATAGTATTACTCGAGTAATACTATAATGTCGTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198273.1-1064s21c1
Sequence:CCGGACATAGCAATTAGCTCATAATCTCGAGATTATGAGCTAATTGCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198273
VALIDATED
LYSMD3 MISSION shRNA Lentiviral Transduction Particles
LysM, putative peptidoglycan-binding, domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198273.1-688s21c1
Sequence:CCGGGAACCTCAATGAGGTAGTATCCTCGAGGATACTACCTCATTGAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198273.1-1000s21c1
Sequence:CCGGCAGCCAACAAGATGATCATAACTCGAGTTATGATCATCTTGTTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253829    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198273.1-2027s21c1
Sequence:CCGGATTCGTTACATAGGCTATATACTCGAGTATATAGCCTATGTAACGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198273.1-323s21c1
Sequence:CCGGCTTGACGACATTATAGTATTACTCGAGTAATACTATAATGTCGTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198273.1-1064s21c1
Sequence:CCGGACATAGCAATTAGCTCATAATCTCGAGATTATGAGCTAATTGCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)