EMAIL THIS PAGE TO A FRIEND

LYSMD4

LysM, putative peptidoglycan-binding, domain containing 4

105 Gene Product Result for
UniProtKB ID: Q5XG99, A6NII6, A8K2N1, Q96LY7
Gene ID:
Mouse(75099) LysM, putative peptidoglycan-binding, domain containing 4
Rat(681647) LysM, putative peptidoglycan-binding, domain containing 4
naked mole-rat(101703992) LysM, putative peptidoglycan-binding, domain containing 4
domestic guinea pig(100736238) LysM, putative peptidoglycan-binding, domain containing 4
Zebrafish(100149102) LysM, putative peptidoglycan-binding, domain containing 4
cow(529775) LysM, putative peptidoglycan-binding, domain containing 4
domestic cat(101099048) LysM, putative peptidoglycan-binding, domain containing 4
dog(488709) LysM, putative peptidoglycan-binding, domain containing 4
chicken(427510) LysM, putative peptidoglycan-binding, domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152449 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152449 Rosetta Predictions human pricing
XM_001057182 Rosetta Predictions rat pricing
NM_175215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366215 predicted 556
2 SASI_Hs01_00131024 predicted 815
3 SASI_Hs02_00366216 predicted 823
4 SASI_Hs02_00366217 predicted 815
5 SASI_Hs02_00366218 predicted 960
6 SASI_Hs01_00131026 predicted 767
7 SASI_Hs01_00131027 predicted 585
8 SASI_Hs01_00131028 predicted 491
9 SASI_Hs01_00131029 predicted 448
10 SASI_Hs02_00366219 predicted 581
11 SASI_Hs01_00131021 predicted 535
12 SASI_Hs01_00131022 predicted 528
13 SASI_Hs01_00131023 predicted 595
14 SASI_Hs01_00131025 predicted 537
15 SASI_Hs01_00131030 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285677 predicted 473
2 SASI_Rn02_00285678 predicted 1306
3 SASI_Rn02_00285679 predicted 1062
4 SASI_Rn02_00285680 predicted 648
5 SASI_Rn02_00285681 predicted 1145
6 SASI_Rn02_00285682 predicted 713
7 SASI_Rn02_00285683 predicted 1353
8 SASI_Rn02_00285684 predicted 1079
9 SASI_Rn02_00285685 predicted 1098
10 SASI_Rn02_00285686 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093363 predicted 712
2 SASI_Mm01_00093364 predicted 1184
3 SASI_Mm01_00093365 predicted 322
4 SASI_Mm01_00093366 predicted 717
5 SASI_Mm01_00093367 predicted 975
6 SASI_Mm01_00093368 predicted 1042
7 SASI_Mm02_00345892 predicted 1107
8 SASI_Mm01_00093369 predicted 1030
9 SASI_Mm01_00093370 predicted 934
10 SASI_Mm01_00093371 predicted 532
11 SASI_Mm01_00093372 predicted 548
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175215
LYSMD4 MISSION shRNA Bacterial Glycerol Stock
LysM, putative peptidoglycan-binding, domain containing 4
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-90s1c1
Sequence:CCGGGACTCCAAACAGCCACGTTTACTCGAGTAAACGTGGCTGTTTGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175215.2-699s1c1
Sequence:CCGGGCTTCTCATTGGGATCGTATTCTCGAGAATACGATCCCAATGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175215.2-102s1c1
Sequence:CCGGCCACGTTTACATGTTCAACAACTCGAGTTGTTGAACATGTAAACGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-351s1c1
Sequence:CCGGCCTGTATGCTTTGAAGTCAATCTCGAGATTGACTTCAAAGCATACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-368s1c1
Sequence:CCGGCAATCAAGATTCCAGTGAGAACTCGAGTTCTCACTGGAATCTTGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175215.2-2022s1c1
Sequence:CCGGGCCTTTAAGATACTATCCAAACTCGAGTTTGGATAGTATCTTAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175215.2-2488s1c1
Sequence:CCGGGCTGTGAAGTTTCTCTTAAATCTCGAGATTTAAGAGAAACTTCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175215.2-379s1c1
Sequence:CCGGCCAGTGAGAAATCATGGGATTCTCGAGAATCCCATGATTTCTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-345s1c1
Sequence:CCGGGCAAGACCTGTATGCTTTGAACTCGAGTTCAAAGCATACAGGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-354s1c1
Sequence:CCGGGTATGCTTTGAAGTCAATCAACTCGAGTTGATTGACTTCAAAGCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175215.2-2415s1c1
Sequence:CCGGCCCATGAATCTTGGTACAATACTCGAGTATTGTACCAAGATTCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175215
LYSMD4 MISSION shRNA shRNA Plasmid DNA
LysM, putative peptidoglycan-binding, domain containing 4
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-90s1c1
Sequence:CCGGGACTCCAAACAGCCACGTTTACTCGAGTAAACGTGGCTGTTTGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175215.2-699s1c1
Sequence:CCGGGCTTCTCATTGGGATCGTATTCTCGAGAATACGATCCCAATGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175215.2-102s1c1
Sequence:CCGGCCACGTTTACATGTTCAACAACTCGAGTTGTTGAACATGTAAACGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-351s1c1
Sequence:CCGGCCTGTATGCTTTGAAGTCAATCTCGAGATTGACTTCAAAGCATACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-368s1c1
Sequence:CCGGCAATCAAGATTCCAGTGAGAACTCGAGTTCTCACTGGAATCTTGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175215.2-2022s1c1
Sequence:CCGGGCCTTTAAGATACTATCCAAACTCGAGTTTGGATAGTATCTTAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175215.2-2488s1c1
Sequence:CCGGGCTGTGAAGTTTCTCTTAAATCTCGAGATTTAAGAGAAACTTCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175215.2-379s1c1
Sequence:CCGGCCAGTGAGAAATCATGGGATTCTCGAGAATCCCATGATTTCTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-345s1c1
Sequence:CCGGGCAAGACCTGTATGCTTTGAACTCGAGTTCAAAGCATACAGGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-354s1c1
Sequence:CCGGGTATGCTTTGAAGTCAATCAACTCGAGTTGATTGACTTCAAAGCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175215.2-2415s1c1
Sequence:CCGGCCCATGAATCTTGGTACAATACTCGAGTATTGTACCAAGATTCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175215
LYSMD4 MISSION shRNA Lentiviral Transduction Particles
LysM, putative peptidoglycan-binding, domain containing 4
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-90s1c1
Sequence:CCGGGACTCCAAACAGCCACGTTTACTCGAGTAAACGTGGCTGTTTGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175215.2-699s1c1
Sequence:CCGGGCTTCTCATTGGGATCGTATTCTCGAGAATACGATCCCAATGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175215.2-102s1c1
Sequence:CCGGCCACGTTTACATGTTCAACAACTCGAGTTGTTGAACATGTAAACGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-351s1c1
Sequence:CCGGCCTGTATGCTTTGAAGTCAATCTCGAGATTGACTTCAAAGCATACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-368s1c1
Sequence:CCGGCAATCAAGATTCCAGTGAGAACTCGAGTTCTCACTGGAATCTTGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175215.2-2022s1c1
Sequence:CCGGGCCTTTAAGATACTATCCAAACTCGAGTTTGGATAGTATCTTAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177260    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175215.2-2488s1c1
Sequence:CCGGGCTGTGAAGTTTCTCTTAAATCTCGAGATTTAAGAGAAACTTCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175215.2-379s1c1
Sequence:CCGGCCAGTGAGAAATCATGGGATTCTCGAGAATCCCATGATTTCTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-345s1c1
Sequence:CCGGGCAAGACCTGTATGCTTTGAACTCGAGTTCAAAGCATACAGGTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175215.2-354s1c1
Sequence:CCGGGTATGCTTTGAAGTCAATCAACTCGAGTTGATTGACTTCAAAGCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197635    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175215.2-2415s1c1
Sequence:CCGGCCCATGAATCTTGGTACAATACTCGAGTATTGTACCAAGATTCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152449
VALIDATED
LYSMD4 MISSION shRNA Bacterial Glycerol Stock
LysM, putative peptidoglycan-binding, domain containing 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152449.2-2586s1c1
Sequence:CCGGCCTGGGTTCCATTAGCAAATTCTCGAGAATTTGCTAATGGAACCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152449.2-2547s1c1
Sequence:CCGGCCGATTTCTCTCCTTTCAGTTCTCGAGAACTGAAAGGAGAGAAATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152449.2-2634s1c1
Sequence:CCGGCCAGAATGATCTTCAGGATAACTCGAGTTATCCTGAAGATCATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152449.2-537s1c1
Sequence:CCGGCAGAGTGATTAACAATGGCAACTCGAGTTGCCATTGTTAATCACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152449.2-549s1c1
Sequence:CCGGCAATGGCAAAGTTGCAGATATCTCGAGATATCTGCAACTTTGCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152449.2-658s1c1
Sequence:CCGGGAGACCCACAAAGAACTGAAACTCGAGTTTCAGTTCTTTGTGGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152449.2-951s1c1
Sequence:CCGGGCTGCTGATTGGTATTGTCTTCTCGAGAAGACAATACCAATCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152449.2-814s1c1
Sequence:CCGGGCAGTGCAGTCAGAAATCTTTCTCGAGAAAGATTTCTGACTGCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152449.2-768s1c1
Sequence:CCGGCCAACTGATGGGCTTCTTTAACTCGAGTTAAAGAAGCCCATCAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152449.2-767s1c1
Sequence:CCGGGCCAACTGATGGGCTTCTTTACTCGAGTAAAGAAGCCCATCAGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152449.2-904s1c1
Sequence:CCGGGATGGTGCAGATTGTGGCATTCTCGAGAATGCCACAATCTGCACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152449
VALIDATED
LYSMD4 MISSION shRNA shRNA Plasmid DNA
LysM, putative peptidoglycan-binding, domain containing 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152449.2-2586s1c1
Sequence:CCGGCCTGGGTTCCATTAGCAAATTCTCGAGAATTTGCTAATGGAACCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152449.2-2547s1c1
Sequence:CCGGCCGATTTCTCTCCTTTCAGTTCTCGAGAACTGAAAGGAGAGAAATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152449.2-2634s1c1
Sequence:CCGGCCAGAATGATCTTCAGGATAACTCGAGTTATCCTGAAGATCATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152449.2-537s1c1
Sequence:CCGGCAGAGTGATTAACAATGGCAACTCGAGTTGCCATTGTTAATCACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152449.2-549s1c1
Sequence:CCGGCAATGGCAAAGTTGCAGATATCTCGAGATATCTGCAACTTTGCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152449.2-658s1c1
Sequence:CCGGGAGACCCACAAAGAACTGAAACTCGAGTTTCAGTTCTTTGTGGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152449.2-951s1c1
Sequence:CCGGGCTGCTGATTGGTATTGTCTTCTCGAGAAGACAATACCAATCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152449.2-814s1c1
Sequence:CCGGGCAGTGCAGTCAGAAATCTTTCTCGAGAAAGATTTCTGACTGCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152449.2-768s1c1
Sequence:CCGGCCAACTGATGGGCTTCTTTAACTCGAGTTAAAGAAGCCCATCAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152449.2-767s1c1
Sequence:CCGGGCCAACTGATGGGCTTCTTTACTCGAGTAAAGAAGCCCATCAGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152449.2-904s1c1
Sequence:CCGGGATGGTGCAGATTGTGGCATTCTCGAGAATGCCACAATCTGCACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152449
VALIDATED
LYSMD4 MISSION shRNA Lentiviral Transduction Particles
LysM, putative peptidoglycan-binding, domain containing 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154094    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152449.2-2586s1c1
Sequence:CCGGCCTGGGTTCCATTAGCAAATTCTCGAGAATTTGCTAATGGAACCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152449.2-2547s1c1
Sequence:CCGGCCGATTTCTCTCCTTTCAGTTCTCGAGAACTGAAAGGAGAGAAATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152449.2-2634s1c1
Sequence:CCGGCCAGAATGATCTTCAGGATAACTCGAGTTATCCTGAAGATCATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152449.2-537s1c1
Sequence:CCGGCAGAGTGATTAACAATGGCAACTCGAGTTGCCATTGTTAATCACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152449.2-549s1c1
Sequence:CCGGCAATGGCAAAGTTGCAGATATCTCGAGATATCTGCAACTTTGCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152449.2-658s1c1
Sequence:CCGGGAGACCCACAAAGAACTGAAACTCGAGTTTCAGTTCTTTGTGGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152449.2-951s1c1
Sequence:CCGGGCTGCTGATTGGTATTGTCTTCTCGAGAAGACAATACCAATCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152449.2-814s1c1
Sequence:CCGGGCAGTGCAGTCAGAAATCTTTCTCGAGAAAGATTTCTGACTGCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152449.2-768s1c1
Sequence:CCGGCCAACTGATGGGCTTCTTTAACTCGAGTTAAAGAAGCCCATCAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152449.2-767s1c1
Sequence:CCGGGCCAACTGATGGGCTTCTTTACTCGAGTAAAGAAGCCCATCAGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152449.2-904s1c1
Sequence:CCGGGATGGTGCAGATTGTGGCATTCTCGAGAATGCCACAATCTGCACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)