EMAIL THIS PAGE TO A FRIEND

LYST

lysosomal trafficking regulator

175 Gene Product Result for
Synonyms: CHS CHS1
Gene ID:
Human(1130) Summary: This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
Mouse(17101) lysosomal trafficking regulator
Rat(85419) lysosomal trafficking regulator
Zebrafish(100150726) lysosomal trafficking regulator
cow(281072) lysosomal trafficking regulator
Horse(100050724) lysosomal trafficking regulator
domestic cat(101081414) lysosomal trafficking regulator
dog(479195) lysosomal trafficking regulator
chicken(421514) lysosomal trafficking regulator
sheep(101115340) lysosomal trafficking regulator
domestic guinea pig(100730206) lysosomal trafficking regulator
naked mole-rat(101707129) lysosomal trafficking regulator
Domestic Rabbit(100339012) lysosomal trafficking regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010748 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010748 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010748 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000081 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000081 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000081 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000081 Rosetta Predictions human pricing
NM_001005736 Rosetta Predictions human pricing
NM_053518 Rosetta Predictions rat pricing
NM_010748 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211412 predicted 2109
2 SASI_Hs02_00301823 predicted 4617
3 SASI_Hs01_00211414 predicted 3132
4 SASI_Hs02_00301824 predicted 10155
5 SASI_Hs02_00301825 predicted 6229
6 SASI_Hs01_00211419 predicted 4429
7 SASI_Hs01_00211420 predicted 2572
8 SASI_Hs02_00301826 predicted 10118
9 SASI_Hs02_00301827 predicted 4571
10 SASI_Hs02_00301828 predicted 9686
11 SASI_Hs01_00211413 predicted 5111
12 SASI_Hs01_00211415 predicted 5376
13 SASI_Hs01_00211416 predicted 2988
14 SASI_Hs01_00211417 predicted 4770
15 SASI_Hs01_00211418 predicted 2561
16 SASI_Hs01_00211421 predicted 2526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012091 predicted 2490
2 SASI_Hs01_00012092 predicted 5491
3 SASI_Hs01_00012093 predicted 3512
4 SASI_Hs01_00012094 predicted 5746
5 SASI_Hs01_00012095 predicted 3361
6 SASI_Hs01_00012096 predicted 5145
7 SASI_Hs01_00012097 predicted 2941
8 SASI_Hs01_00012098 predicted 4803
9 SASI_Hs01_00012099 predicted 2952
10 SASI_Hs01_00012100 predicted 2901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109194 predicted 9533
2 SASI_Rn01_00109195 predicted 9244
3 SASI_Rn01_00109196 predicted 7439
4 SASI_Rn01_00109197 predicted 6951
5 SASI_Rn02_00266129 predicted 2118
6 SASI_Rn01_00109200 predicted 5921
7 SASI_Rn01_00109201 predicted 2804
8 SASI_Rn01_00109202 predicted 5818
9 SASI_Rn01_00109203 predicted 5229
10 SASI_Rn02_00266130 predicted 9158
11 SASI_Rn01_00109198 predicted 1064
12 SASI_Rn01_00109199 predicted 8783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022366 predicted 7043
2 SASI_Mm01_00022367 predicted 9712
3 SASI_Mm01_00022368 predicted 9373
4 SASI_Mm01_00022369 predicted 3412
5 SASI_Mm02_00319262 predicted 4272
6 SASI_Mm01_00022370 predicted 7141
7 SASI_Mm01_00022371 predicted 4858
8 SASI_Mm01_00022373 predicted 10092
9 SASI_Mm01_00022374 predicted 4869
10 SASI_Mm01_00022375 predicted 9229
11 SASI_Mm01_00022372 predicted 4391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010748
LYST MISSION shRNA Bacterial Glycerol Stock
lysosomal trafficking regulator
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010748.2-8373s21c1
Sequence:GTACCGGGAAGATTGCTAGCGCATATTTCTCGAGAAATATGCGCTAGCAATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010748.2-5654s21c1
Sequence:GTACCGGGCATTAGCACTGCGGGTTATACTCGAGTATAACCCGCAGTGCTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010748.1-5669s1c1
Sequence:CCGGCGGGTTATACTGTCTTTAATTCTCGAGAATTAAAGACAGTATAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010748.1-10334s1c1
Sequence:CCGGCGGGCTTTAGAAACCATGATACTCGAGTATCATGGTTTCTAAAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010748.1-11398s1c1
Sequence:CCGGGCCCATCATAAGCCTGACATTCTCGAGAATGTCAGGCTTATGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010748.1-11626s1c1
Sequence:CCGGGCAGATATCCAGGAAAGACAACTCGAGTTGTCTTTCCTGGATATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010748.1-6117s1c1
Sequence:CCGGCCCGAGAAGTTTGTAGATCATCTCGAGATGATCTACAAACTTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010748
LYST MISSION shRNA shRNA Plasmid DNA
lysosomal trafficking regulator
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010748.2-8373s21c1
Sequence:GTACCGGGAAGATTGCTAGCGCATATTTCTCGAGAAATATGCGCTAGCAATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010748.2-5654s21c1
Sequence:GTACCGGGCATTAGCACTGCGGGTTATACTCGAGTATAACCCGCAGTGCTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010748.1-5669s1c1
Sequence:CCGGCGGGTTATACTGTCTTTAATTCTCGAGAATTAAAGACAGTATAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010748.1-10334s1c1
Sequence:CCGGCGGGCTTTAGAAACCATGATACTCGAGTATCATGGTTTCTAAAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010748.1-11398s1c1
Sequence:CCGGGCCCATCATAAGCCTGACATTCTCGAGAATGTCAGGCTTATGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010748.1-11626s1c1
Sequence:CCGGGCAGATATCCAGGAAAGACAACTCGAGTTGTCTTTCCTGGATATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010748.1-6117s1c1
Sequence:CCGGCCCGAGAAGTTTGTAGATCATCTCGAGATGATCTACAAACTTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010748
LYST MISSION shRNA Lentiviral Transduction Particles
lysosomal trafficking regulator
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010748.2-8373s21c1
Sequence:GTACCGGGAAGATTGCTAGCGCATATTTCTCGAGAAATATGCGCTAGCAATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010748.2-5654s21c1
Sequence:GTACCGGGCATTAGCACTGCGGGTTATACTCGAGTATAACCCGCAGTGCTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010748.1-5669s1c1
Sequence:CCGGCGGGTTATACTGTCTTTAATTCTCGAGAATTAAAGACAGTATAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010748.1-10334s1c1
Sequence:CCGGCGGGCTTTAGAAACCATGATACTCGAGTATCATGGTTTCTAAAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010748.1-11398s1c1
Sequence:CCGGGCCCATCATAAGCCTGACATTCTCGAGAATGTCAGGCTTATGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010748.1-11626s1c1
Sequence:CCGGGCAGATATCCAGGAAAGACAACTCGAGTTGTCTTTCCTGGATATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010748.1-6117s1c1
Sequence:CCGGCCCGAGAAGTTTGTAGATCATCTCGAGATGATCTACAAACTTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000081
LYST MISSION shRNA Bacterial Glycerol Stock
lysosomal trafficking regulator
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000081.2-11820s21c1
Sequence:GTACCGGTAAGCCTCGCATGGTACATTACTCGAGTAATGTACCATGCGAGGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000081.2-9577s21c1
Sequence:GTACCGGATGGTATACTGGGCAAATTACCTCGAGGTAATTTGCCCAGTATACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-10178s1c1
Sequence:CCGGCGCGTAATGATCCTCGTCTTTCTCGAGAAAGACGAGGATCATTACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000081.2-7737s21c1
Sequence:GTACCGGGGGTTATTGAAGACCTTATTGCTCGAGCAATAAGGTCTTCAATAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-5055s1c1
Sequence:CCGGGCCTGATGTTACTTTGGATTTCTCGAGAAATCCAAAGTAACATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-493s1c1
Sequence:CCGGGCAGATATAATCCTGACCAAACTCGAGTTTGGTCAGGATTATATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-3696s1c1
Sequence:CCGGCGGGAATTATTCAGCAGATTTCTCGAGAAATCTGCTGAATAATTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-2538s1c1
Sequence:CCGGCCTGCTTAAATCCAGGGTAATCTCGAGATTACCCTGGATTTAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000081
LYST MISSION shRNA shRNA Plasmid DNA
lysosomal trafficking regulator
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000081.2-11820s21c1
Sequence:GTACCGGTAAGCCTCGCATGGTACATTACTCGAGTAATGTACCATGCGAGGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000081.2-9577s21c1
Sequence:GTACCGGATGGTATACTGGGCAAATTACCTCGAGGTAATTTGCCCAGTATACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-10178s1c1
Sequence:CCGGCGCGTAATGATCCTCGTCTTTCTCGAGAAAGACGAGGATCATTACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000081.2-7737s21c1
Sequence:GTACCGGGGGTTATTGAAGACCTTATTGCTCGAGCAATAAGGTCTTCAATAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-5055s1c1
Sequence:CCGGGCCTGATGTTACTTTGGATTTCTCGAGAAATCCAAAGTAACATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-493s1c1
Sequence:CCGGGCAGATATAATCCTGACCAAACTCGAGTTTGGTCAGGATTATATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-3696s1c1
Sequence:CCGGCGGGAATTATTCAGCAGATTTCTCGAGAAATCTGCTGAATAATTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-2538s1c1
Sequence:CCGGCCTGCTTAAATCCAGGGTAATCTCGAGATTACCCTGGATTTAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000081
LYST MISSION shRNA Lentiviral Transduction Particles
lysosomal trafficking regulator
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000081.2-11820s21c1
Sequence:GTACCGGTAAGCCTCGCATGGTACATTACTCGAGTAATGTACCATGCGAGGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000081.2-9577s21c1
Sequence:GTACCGGATGGTATACTGGGCAAATTACCTCGAGGTAATTTGCCCAGTATACCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-10178s1c1
Sequence:CCGGCGCGTAATGATCCTCGTCTTTCTCGAGAAAGACGAGGATCATTACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000081.2-7737s21c1
Sequence:GTACCGGGGGTTATTGAAGACCTTATTGCTCGAGCAATAAGGTCTTCAATAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-5055s1c1
Sequence:CCGGGCCTGATGTTACTTTGGATTTCTCGAGAAATCCAAAGTAACATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-493s1c1
Sequence:CCGGGCAGATATAATCCTGACCAAACTCGAGTTTGGTCAGGATTATATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-3696s1c1
Sequence:CCGGCGGGAATTATTCAGCAGATTTCTCGAGAAATCTGCTGAATAATTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000081.1-2538s1c1
Sequence:CCGGCCTGCTTAAATCCAGGGTAATCTCGAGATTACCCTGGATTTAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)