EMAIL THIS PAGE TO A FRIEND

LYZL2

lysozyme-like 2

38 Gene Product Result for
Species: Human LYZL2(119180)
UniProtKB ID: Q7Z4W2, Q6NZ69
Gene ID:
Human(119180) Summary: Lysozymes (see LYZ; MIM 153450), especially C-type lysozymes, are well-recognized bacteriolytic factors widely distributed in the animal kingdom and play a mainly protective role in host defense. LYZL2 is a member of a family of lysozyme-like genes (Zhang et al., 2005 [PubMed 16014814]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183058 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108751 MISSION® esiRNA esiRNA human LYZL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183058 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127346 predicted 285
2 SASI_Hs01_00127347 predicted 302
3 SASI_Hs01_00127348 predicted 215
4 SASI_Hs01_00127349 predicted 218
5 SASI_Hs01_00127350 predicted 474
6 SASI_Hs01_00127351 predicted 443
7 SASI_Hs02_00371217 predicted 471
8 SASI_Hs01_00127352 predicted 375
9 SASI_Hs01_00127353 predicted 468
10 SASI_Hs01_00127354 predicted 287
11 SASI_Hs01_00127345 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183058
LYZL2 MISSION shRNA Bacterial Glycerol Stock
lysozyme-like 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-509s1c1
Sequence:CCGGCAAGGCTGGAAGAAACACTGTCTCGAGACAGTGTTTCTTCCAGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-440s1c1
Sequence:CCGGGATGACCTCACAGATGCGATTCTCGAGAATCGCATCTGTGAGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-491s1c1
Sequence:CCGGCAAGGAATGAACTATTGGCAACTCGAGTTGCCAATAGTTCATTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-283s1c1
Sequence:CCGGGTATTATGAGAGCGGCTACAACTCGAGTTGTAGCCGCTCTCATAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-455s1c1
Sequence:CCGGGCGATTATCTGTGCCAAGAAACTCGAGTTTCTTGGCACAGATAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-495s1c1
Sequence:CCGGGAATGAACTATTGGCAAGGCTCTCGAGAGCCTTGCCAATAGTTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-349s1c1
Sequence:CCGGCATCTTCCAGATCAACAGCTTCTCGAGAAGCTGTTGATCTGGAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-253s1c1
Sequence:CCGGCTTCAGCCTTGGAAACTGGATCTCGAGATCCAGTTTCCAAGGCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-343s1c1
Sequence:CCGGCTACGGCATCTTCCAGATCAACTCGAGTTGATCTGGAAGATGCCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-259s1c1
Sequence:CCGGCCTTGGAAACTGGATCTGCATCTCGAGATGCAGATCCAGTTTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-385s1c1
Sequence:CCGGCGGAAAGCTGAAGGAGAACAACTCGAGTTGTTCTCCTTCAGCTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183058
LYZL2 MISSION shRNA shRNA Plasmid DNA
lysozyme-like 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-509s1c1
Sequence:CCGGCAAGGCTGGAAGAAACACTGTCTCGAGACAGTGTTTCTTCCAGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-440s1c1
Sequence:CCGGGATGACCTCACAGATGCGATTCTCGAGAATCGCATCTGTGAGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-491s1c1
Sequence:CCGGCAAGGAATGAACTATTGGCAACTCGAGTTGCCAATAGTTCATTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-283s1c1
Sequence:CCGGGTATTATGAGAGCGGCTACAACTCGAGTTGTAGCCGCTCTCATAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-455s1c1
Sequence:CCGGGCGATTATCTGTGCCAAGAAACTCGAGTTTCTTGGCACAGATAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-495s1c1
Sequence:CCGGGAATGAACTATTGGCAAGGCTCTCGAGAGCCTTGCCAATAGTTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-349s1c1
Sequence:CCGGCATCTTCCAGATCAACAGCTTCTCGAGAAGCTGTTGATCTGGAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-253s1c1
Sequence:CCGGCTTCAGCCTTGGAAACTGGATCTCGAGATCCAGTTTCCAAGGCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-343s1c1
Sequence:CCGGCTACGGCATCTTCCAGATCAACTCGAGTTGATCTGGAAGATGCCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-259s1c1
Sequence:CCGGCCTTGGAAACTGGATCTGCATCTCGAGATGCAGATCCAGTTTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-385s1c1
Sequence:CCGGCGGAAAGCTGAAGGAGAACAACTCGAGTTGTTCTCCTTCAGCTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183058
LYZL2 MISSION shRNA Lentiviral Transduction Particles
lysozyme-like 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-509s1c1
Sequence:CCGGCAAGGCTGGAAGAAACACTGTCTCGAGACAGTGTTTCTTCCAGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-440s1c1
Sequence:CCGGGATGACCTCACAGATGCGATTCTCGAGAATCGCATCTGTGAGGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-491s1c1
Sequence:CCGGCAAGGAATGAACTATTGGCAACTCGAGTTGCCAATAGTTCATTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-283s1c1
Sequence:CCGGGTATTATGAGAGCGGCTACAACTCGAGTTGTAGCCGCTCTCATAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-455s1c1
Sequence:CCGGGCGATTATCTGTGCCAAGAAACTCGAGTTTCTTGGCACAGATAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-495s1c1
Sequence:CCGGGAATGAACTATTGGCAAGGCTCTCGAGAGCCTTGCCAATAGTTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-349s1c1
Sequence:CCGGCATCTTCCAGATCAACAGCTTCTCGAGAAGCTGTTGATCTGGAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183058.1-253s1c1
Sequence:CCGGCTTCAGCCTTGGAAACTGGATCTCGAGATCCAGTTTCCAAGGCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-343s1c1
Sequence:CCGGCTACGGCATCTTCCAGATCAACTCGAGTTGATCTGGAAGATGCCGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-259s1c1
Sequence:CCGGCCTTGGAAACTGGATCTGCATCTCGAGATGCAGATCCAGTTTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183058.1-385s1c1
Sequence:CCGGCGGAAAGCTGAAGGAGAACAACTCGAGTTGTTCTCCTTCAGCTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)