EMAIL THIS PAGE TO A FRIEND

LYZL4

lysozyme-like 4

53 Gene Product Result for
Synonyms: 1810009N24Rik LYC4
UniProtKB ID: Q96KX0
Gene ID:
Human(131375) Summary: Lysozymes (see LYZ; MIM 153450), especially C-type lysozymes, are well-recognized bacteriolytic factors widely distributed in the animal kingdom and play a mainly protective role in host defense. LYZL4 is a member of a family of lysozyme-like genes (Zhang et al., 2005 [PubMed 16014814]
Mouse(69032) lysozyme-like 4
Rat(363168) lysozyme-like 4
domestic cat(101096597) lysozyme-like 4
cow(523887) lysozyme-like 4
Goat(100860942) lysozyme-like 4
sheep(100579170) lysozyme-like 4
naked mole-rat(101725442) lysozyme-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144634 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144634 Rosetta Predictions human pricing
XM_001078029 Rosetta Predictions rat pricing
XM_343507 Rosetta Predictions rat pricing
NM_026915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155339 predicted 574
2 SASI_Hs01_00155340 predicted 535
3 SASI_Hs02_00364475 predicted 450
4 SASI_Hs01_00155342 predicted 524
5 SASI_Hs01_00155343 predicted 536
6 SASI_Hs01_00155344 predicted 361
7 SASI_Hs01_00155345 predicted 517
8 SASI_Hs01_00155346 predicted 337
9 SASI_Hs01_00155347 predicted 511
10 SASI_Hs01_00155348 predicted 336
11 SASI_Hs01_00155341 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359410 predicted 280
2 SASI_Rn02_00359411 predicted 348
3 SASI_Rn02_00359412 predicted 383
4 SASI_Rn02_00359413 predicted 315
5 SASI_Rn02_00359414 predicted 337
6 SASI_Rn02_00359415 predicted 460
7 SASI_Rn02_00359416 predicted 279
8 SASI_Rn02_00359417 predicted 373
9 SASI_Rn02_00359418 predicted 286
10 SASI_Rn02_00359419 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395934 predicted 759
2 SASI_Rn02_00395935 predicted 617
3 SASI_Rn02_00395936 predicted 1324
4 SASI_Rn02_00395937 predicted 1336
5 SASI_Rn02_00395938 predicted 507
6 SASI_Rn02_00395939 predicted 1386
7 SASI_Rn02_00395940 predicted 801
8 SASI_Rn02_00395941 predicted 1307
9 SASI_Rn02_00395942 predicted 478
10 SASI_Rn02_00395943 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041913 predicted 587
2 SASI_Mm01_00041914 predicted 628
3 SASI_Mm01_00041915 predicted 378
4 SASI_Mm01_00041916 predicted 659
5 SASI_Mm01_00041917 predicted 687
6 SASI_Mm01_00041918 predicted 590
7 SASI_Mm01_00041919 predicted 591
8 SASI_Mm01_00041920 predicted 568
9 SASI_Mm01_00041921 predicted 445
10 SASI_Mm01_00041922 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026915
LYZL4 MISSION shRNA Bacterial Glycerol Stock
lysozyme-like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026915.2-867s1c1
Sequence:CCGGCTCTCCTGTTTGCTGCTTCAACTCGAGTTGAAGCAGCAAACAGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026915.2-676s1c1
Sequence:CCGGTCCAAACTTAAAGGATACGATCTCGAGATCGTATCCTTTAAGTTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026915.2-455s1c1
Sequence:CCGGGTGGCTAAGATGCTCTATGATCTCGAGATCATAGAGCATCTTAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026915.2-598s1c1
Sequence:CCGGCCTCTTTCAGATTCGTGACAACTCGAGTTGTCACGAATCTGAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026915.2-665s1c1
Sequence:CCGGGCTTTACTGAATCCAAACTTACTCGAGTAAGTTTGGATTCAGTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026915
LYZL4 MISSION shRNA shRNA Plasmid DNA
lysozyme-like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026915.2-867s1c1
Sequence:CCGGCTCTCCTGTTTGCTGCTTCAACTCGAGTTGAAGCAGCAAACAGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026915.2-676s1c1
Sequence:CCGGTCCAAACTTAAAGGATACGATCTCGAGATCGTATCCTTTAAGTTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026915.2-455s1c1
Sequence:CCGGGTGGCTAAGATGCTCTATGATCTCGAGATCATAGAGCATCTTAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026915.2-598s1c1
Sequence:CCGGCCTCTTTCAGATTCGTGACAACTCGAGTTGTCACGAATCTGAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026915.2-665s1c1
Sequence:CCGGGCTTTACTGAATCCAAACTTACTCGAGTAAGTTTGGATTCAGTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026915
LYZL4 MISSION shRNA Lentiviral Transduction Particles
lysozyme-like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026915.2-867s1c1
Sequence:CCGGCTCTCCTGTTTGCTGCTTCAACTCGAGTTGAAGCAGCAAACAGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026915.2-676s1c1
Sequence:CCGGTCCAAACTTAAAGGATACGATCTCGAGATCGTATCCTTTAAGTTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026915.2-455s1c1
Sequence:CCGGGTGGCTAAGATGCTCTATGATCTCGAGATCATAGAGCATCTTAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026915.2-598s1c1
Sequence:CCGGCCTCTTTCAGATTCGTGACAACTCGAGTTGTCACGAATCTGAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026915.2-665s1c1
Sequence:CCGGGCTTTACTGAATCCAAACTTACTCGAGTAAGTTTGGATTCAGTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144634
LYZL4 MISSION shRNA Bacterial Glycerol Stock
lysozyme-like 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-331s1c1
Sequence:CCGGGCTAAGAAACTCCACGATGGACTCGAGTCCATCGTGGAGTTTCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-547s1c1
Sequence:CCGGCTGAATCCTAATTTAGAGAAGCTCGAGCTTCTCTAAATTAGGATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-539s1c1
Sequence:CCGGCCGCTTTACTGAATCCTAATTCTCGAGAATTAGGATTCAGTAAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158669    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144634.2-719s1c1
Sequence:CCGGCAGTTGCATCTTGTGAATGAACTCGAGTTCATTCACAAGATGCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-564s1c1
Sequence:CCGGGAAGACAATTAAATGTGCCAACTCGAGTTGGCACATTTAATTGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-295s1c1
Sequence:CCGGCCAAGTGGTGCTTACATCTTGCTCGAGCAAGATGTAAGCACCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144634.2-426s21c1
Sequence:CCGGCATGGCCATCTACGAGAACACCTCGAGGTGTTCTCGTAGATGGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144634.2-291s21c1
Sequence:CCGGGGTTCCAAGTGGTGCTTACATCTCGAGATGTAAGCACCACTTGGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144634.2-636s21c1
Sequence:CCGGGTACTGCCAGTACTCCGATACCTCGAGGTATCGGAGTACTGGCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144634
LYZL4 MISSION shRNA shRNA Plasmid DNA
lysozyme-like 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-331s1c1
Sequence:CCGGGCTAAGAAACTCCACGATGGACTCGAGTCCATCGTGGAGTTTCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-547s1c1
Sequence:CCGGCTGAATCCTAATTTAGAGAAGCTCGAGCTTCTCTAAATTAGGATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-539s1c1
Sequence:CCGGCCGCTTTACTGAATCCTAATTCTCGAGAATTAGGATTCAGTAAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158669    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144634.2-719s1c1
Sequence:CCGGCAGTTGCATCTTGTGAATGAACTCGAGTTCATTCACAAGATGCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-564s1c1
Sequence:CCGGGAAGACAATTAAATGTGCCAACTCGAGTTGGCACATTTAATTGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-295s1c1
Sequence:CCGGCCAAGTGGTGCTTACATCTTGCTCGAGCAAGATGTAAGCACCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144634.2-426s21c1
Sequence:CCGGCATGGCCATCTACGAGAACACCTCGAGGTGTTCTCGTAGATGGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144634.2-291s21c1
Sequence:CCGGGGTTCCAAGTGGTGCTTACATCTCGAGATGTAAGCACCACTTGGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144634.2-636s21c1
Sequence:CCGGGTACTGCCAGTACTCCGATACCTCGAGGTATCGGAGTACTGGCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144634
LYZL4 MISSION shRNA Lentiviral Transduction Particles
lysozyme-like 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-331s1c1
Sequence:CCGGGCTAAGAAACTCCACGATGGACTCGAGTCCATCGTGGAGTTTCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-547s1c1
Sequence:CCGGCTGAATCCTAATTTAGAGAAGCTCGAGCTTCTCTAAATTAGGATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-539s1c1
Sequence:CCGGCCGCTTTACTGAATCCTAATTCTCGAGAATTAGGATTCAGTAAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158669    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144634.2-719s1c1
Sequence:CCGGCAGTTGCATCTTGTGAATGAACTCGAGTTCATTCACAAGATGCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-564s1c1
Sequence:CCGGGAAGACAATTAAATGTGCCAACTCGAGTTGGCACATTTAATTGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144634.2-295s1c1
Sequence:CCGGCCAAGTGGTGCTTACATCTTGCTCGAGCAAGATGTAAGCACCACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144634.2-426s21c1
Sequence:CCGGCATGGCCATCTACGAGAACACCTCGAGGTGTTCTCGTAGATGGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144634.2-291s21c1
Sequence:CCGGGGTTCCAAGTGGTGCTTACATCTCGAGATGTAAGCACCACTTGGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144634.2-636s21c1
Sequence:CCGGGTACTGCCAGTACTCCGATACCTCGAGGTATCGGAGTACTGGCAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)