EMAIL THIS PAGE TO A FRIEND

LYZL6

lysozyme-like 6

87 Gene Product Result for
Synonyms: LYC1 PRO1485 TKAL754 UNQ754
UniProtKB ID: O75951, Q6UW30
Gene ID:
Human(57151) Summary: This gene encodes a member of the C-type lysozyme/alpha-lactalbumin family. C-type lysozymes are bacteriolytic factors that play a role in host defense, whereas alpha-lactalbumins mediate lactose biosynthesis. The encoded protein contains catalytic residues characteristic of C-type lysozymes and may play a role in male reproduction. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(69444) lysozyme-like 6
Rat(287751) lysozyme-like 6
sheep(101119574) lysozyme-like 6
dog(480492) lysozyme-like 6
cow(540048) lysozyme-like 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020426 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027083 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027083 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027083 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020426 Rosetta Predictions human pricing
XM_001081540 Rosetta Predictions rat pricing
XM_213497 Rosetta Predictions rat pricing
NM_027083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103922 predicted 378
2 SASI_Hs02_00353439 predicted 209
3 SASI_Hs01_00103923 predicted 382
4 SASI_Hs01_00103924 predicted 395
5 SASI_Hs01_00103925 predicted 424
6 SASI_Hs01_00103926 predicted 306
7 SASI_Hs01_00103927 predicted 377
8 SASI_Hs01_00103929 predicted 437
9 SASI_Hs02_00353440 predicted 302
10 SASI_Hs02_00353441 predicted 341
11 SASI_Hs01_00103921 predicted 641
12 SASI_Hs01_00103928 predicted 527
13 SASI_Hs01_00103930 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372348 predicted 311
2 SASI_Rn02_00372349 predicted 455
3 SASI_Rn02_00372350 predicted 519
4 SASI_Rn02_00372351 predicted 236
5 SASI_Rn02_00372352 predicted 268
6 SASI_Rn02_00372353 predicted 549
7 SASI_Rn02_00372354 predicted 324
8 SASI_Rn02_00372355 predicted 452
9 SASI_Rn02_00372356 predicted 314
10 SASI_Rn02_00372357 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374656 predicted 310
2 SASI_Rn02_00374657 predicted 454
3 SASI_Rn02_00374658 predicted 523
4 SASI_Rn02_00374659 predicted 234
5 SASI_Rn02_00374660 predicted 268
6 SASI_Rn02_00374661 predicted 547
7 SASI_Rn02_00374662 predicted 321
8 SASI_Rn02_00374663 predicted 450
9 SASI_Rn02_00374664 predicted 313
10 SASI_Rn02_00374665 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115325 predicted 550
2 SASI_Mm01_00115326 predicted 551
3 SASI_Mm01_00115327 predicted 421
4 SASI_Mm01_00115328 predicted 251
5 SASI_Mm01_00115329 predicted 345
6 SASI_Mm01_00115330 predicted 212
7 SASI_Mm01_00115331 predicted 563
8 SASI_Mm01_00115332 predicted 216
9 SASI_Mm01_00115333 predicted 382
10 SASI_Mm02_00331508 predicted 248
11 SASI_Mm01_00115334 predicted 467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020426
LYZL6 MISSION shRNA Bacterial Glycerol Stock
lysozyme-like 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020426.1-675s21c1
Sequence:CCGGTGCCTCCACTTCATGTTATTTCTCGAGAAATAACATGAAGTGGAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020426.1-644s21c1
Sequence:CCGGCACTCAGGGATTCTTCATTTCCTCGAGGAAATGAAGAATCCCTGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020426.1-700s1c1
Sequence:CCGGCCCTTCCCATTTACAACTAAACTCGAGTTTAGTTGTAAATGGGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020426.1-402s1c1
Sequence:CCGGCGATTATAAGAGTTACTCGGACTCGAGTCCGAGTAACTCTTATAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020426.1-448s1c1
Sequence:CCGGGATCTGCTGAATCCCAACCTTCTCGAGAAGGTTGGGATTCAGCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020426.1-180s1c1
Sequence:CCGGCAGCAGCTTTCTTGCCCTAAACTCGAGTTTAGGGCAAGAAAGCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020426.1-516s21c1
Sequence:CCGGGATGAACAACTGGGTAGAATGCTCGAGCATTCTACCCAGTTGTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020426.1-646s1c1
Sequence:CCGGCTCAGGGATTCTTCATTTCTTCTCGAGAAGAAATGAAGAATCCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020426.1-307s1c1
Sequence:CCGGGTGGAAAGCAAGTTCAACATACTCGAGTATGTTGAACTTGCTTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020426
LYZL6 MISSION shRNA shRNA Plasmid DNA
lysozyme-like 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020426.1-675s21c1
Sequence:CCGGTGCCTCCACTTCATGTTATTTCTCGAGAAATAACATGAAGTGGAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020426.1-644s21c1
Sequence:CCGGCACTCAGGGATTCTTCATTTCCTCGAGGAAATGAAGAATCCCTGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020426.1-700s1c1
Sequence:CCGGCCCTTCCCATTTACAACTAAACTCGAGTTTAGTTGTAAATGGGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020426.1-402s1c1
Sequence:CCGGCGATTATAAGAGTTACTCGGACTCGAGTCCGAGTAACTCTTATAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020426.1-448s1c1
Sequence:CCGGGATCTGCTGAATCCCAACCTTCTCGAGAAGGTTGGGATTCAGCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020426.1-180s1c1
Sequence:CCGGCAGCAGCTTTCTTGCCCTAAACTCGAGTTTAGGGCAAGAAAGCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020426.1-516s21c1
Sequence:CCGGGATGAACAACTGGGTAGAATGCTCGAGCATTCTACCCAGTTGTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020426.1-646s1c1
Sequence:CCGGCTCAGGGATTCTTCATTTCTTCTCGAGAAGAAATGAAGAATCCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020426.1-307s1c1
Sequence:CCGGGTGGAAAGCAAGTTCAACATACTCGAGTATGTTGAACTTGCTTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020426
LYZL6 MISSION shRNA Lentiviral Transduction Particles
lysozyme-like 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020426.1-675s21c1
Sequence:CCGGTGCCTCCACTTCATGTTATTTCTCGAGAAATAACATGAAGTGGAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020426.1-644s21c1
Sequence:CCGGCACTCAGGGATTCTTCATTTCCTCGAGGAAATGAAGAATCCCTGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020426.1-700s1c1
Sequence:CCGGCCCTTCCCATTTACAACTAAACTCGAGTTTAGTTGTAAATGGGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020426.1-402s1c1
Sequence:CCGGCGATTATAAGAGTTACTCGGACTCGAGTCCGAGTAACTCTTATAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020426.1-448s1c1
Sequence:CCGGGATCTGCTGAATCCCAACCTTCTCGAGAAGGTTGGGATTCAGCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020426.1-180s1c1
Sequence:CCGGCAGCAGCTTTCTTGCCCTAAACTCGAGTTTAGGGCAAGAAAGCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020426.1-516s21c1
Sequence:CCGGGATGAACAACTGGGTAGAATGCTCGAGCATTCTACCCAGTTGTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151651    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020426.1-646s1c1
Sequence:CCGGCTCAGGGATTCTTCATTTCTTCTCGAGAAGAAATGAAGAATCCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020426.1-307s1c1
Sequence:CCGGGTGGAAAGCAAGTTCAACATACTCGAGTATGTTGAACTTGCTTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027083
LYZL6 MISSION shRNA Bacterial Glycerol Stock
lysozyme-like 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000099845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027083.1-682s1c1
Sequence:CCGGCCTTGGACATTCTTCACTATTCTCGAGAATAGTGAAGAATGTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027083.1-258s1c1
Sequence:CCGGCGCTGTAGTTTGGCCAAGATTCTCGAGAATCTTGGCCAAACTACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027083.1-498s1c1
Sequence:CCGGCCCAACCTCATTTCAACCATTCTCGAGAATGGTTGAAATGAGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027083.1-383s1c1
Sequence:CCGGCGTTGATGGTAGCTTCGACTACTCGAGTAGTCGAAGCTACCATCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027083
LYZL6 MISSION shRNA shRNA Plasmid DNA
lysozyme-like 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000099845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027083.1-682s1c1
Sequence:CCGGCCTTGGACATTCTTCACTATTCTCGAGAATAGTGAAGAATGTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027083.1-258s1c1
Sequence:CCGGCGCTGTAGTTTGGCCAAGATTCTCGAGAATCTTGGCCAAACTACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027083.1-498s1c1
Sequence:CCGGCCCAACCTCATTTCAACCATTCTCGAGAATGGTTGAAATGAGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027083.1-383s1c1
Sequence:CCGGCGTTGATGGTAGCTTCGACTACTCGAGTAGTCGAAGCTACCATCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027083
LYZL6 MISSION shRNA Lentiviral Transduction Particles
lysozyme-like 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000099845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027083.1-682s1c1
Sequence:CCGGCCTTGGACATTCTTCACTATTCTCGAGAATAGTGAAGAATGTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027083.1-258s1c1
Sequence:CCGGCGCTGTAGTTTGGCCAAGATTCTCGAGAATCTTGGCCAAACTACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027083.1-498s1c1
Sequence:CCGGCCCAACCTCATTTCAACCATTCTCGAGAATGGTTGAAATGAGGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027083.1-383s1c1
Sequence:CCGGCGTTGATGGTAGCTTCGACTACTCGAGTAGTCGAAGCTACCATCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)