EMAIL THIS PAGE TO A FRIEND

LZIC

leucine zipper and CTNNBIP1 domain containing

96 Gene Product Result for
UniProtKB ID: Q8WZA0, B2R6F0, Q96IU1
Gene ID:
Mouse(69151) leucine zipper and CTNNBIP1 domain containing
Rat(366507) leucine zipper and CTNNBIP1 domain containing
Zebrafish(436871) leucine zipper and CTNNBIP1 domain containing
cow(767886) leucine zipper and CTNNBIP1 domain containing
domestic cat(101095029) leucine zipper and CTNNBIP1 domain containing
dog(491440) leucine zipper and CTNNBIP1 domain containing
chicken(419445) leucine zipper and CTNNBIP1 domain containing
sheep(101116332) leucine zipper and CTNNBIP1 domain containing
domestic guinea pig(100720070) leucine zipper and CTNNBIP1 domain containing
naked mole-rat(101709589) leucine zipper and CTNNBIP1 domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032368 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026963 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026963 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026963 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006641 MISSION® esiRNA esiRNA targeting human LZIC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032368 Rosetta Predictions human pricing
NM_001013241 Rosetta Predictions rat pricing
NM_026963 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359753 predicted 352
2 SASI_Hs01_00200727 predicted 213
3 SASI_Hs01_00200728 predicted 309
4 SASI_Hs01_00200729 predicted 248
5 SASI_Hs01_00200731 predicted 296
6 SASI_Hs01_00200733 predicted 367
7 SASI_Hs01_00200734 predicted 305
8 SASI_Hs01_00200735 predicted 343
9 SASI_Hs01_00200736 predicted 200
10 SASI_Hs02_00359754 predicted 446
11 SASI_Hs01_00200730 predicted 389
12 SASI_Hs01_00200732 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113751 predicted 558
2 SASI_Rn02_00201066 predicted 532
3 SASI_Rn01_00113752 predicted 429
4 SASI_Rn01_00113753 predicted 943
5 SASI_Rn01_00113754 predicted 1071
6 SASI_Rn01_00113755 predicted 615
7 SASI_Rn01_00113757 predicted 443
8 SASI_Rn01_00113758 predicted 530
9 SASI_Rn01_00113759 predicted 571
10 SASI_Rn01_00113760 predicted 1091
11 SASI_Rn01_00113756 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184332 predicted 1006
2 SASI_Mm01_00184333 predicted 1136
3 SASI_Mm01_00184334 predicted 1115
4 SASI_Mm01_00184335 predicted 916
5 SASI_Mm01_00184337 predicted 694
6 SASI_Mm01_00184339 predicted 822
7 SASI_Mm01_00184341 predicted 1320
8 SASI_Mm02_00331281 predicted 919
9 SASI_Mm02_00331282 predicted 1142
10 SASI_Mm02_00331283 predicted 1458
11 SASI_Mm01_00184336 predicted 1419
12 SASI_Mm01_00184338 predicted 758
13 SASI_Mm01_00184340 predicted 870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032368
VALIDATED
LZIC MISSION shRNA Bacterial Glycerol Stock
leucine zipper and CTNNBIP1 domain containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032368.3-1122s1c1
Sequence:CCGGGCAAGCTCAATAGACTTCATACTCGAGTATGAAGTCTATTGAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032368.3-535s1c1
Sequence:CCGGACTCAACAGAAAGTGGAGATACTCGAGTATCTCCACTTTCTGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032368.3-638s1c1
Sequence:CCGGGCCAGTTTGAGAAAGTCTCTACTCGAGTAGAGACTTTCTCAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032368.3-214s1c1
Sequence:CCGGGATAGACTCATGCAACAATTACTCGAGTAATTGTTGCATGAGTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032368.3-301s1c1
Sequence:CCGGCTGGAGCAACTAAGTGAATTTCTCGAGAAATTCACTTAGTTGCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032368
VALIDATED
LZIC MISSION shRNA shRNA Plasmid DNA
leucine zipper and CTNNBIP1 domain containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032368.3-1122s1c1
Sequence:CCGGGCAAGCTCAATAGACTTCATACTCGAGTATGAAGTCTATTGAGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032368.3-535s1c1
Sequence:CCGGACTCAACAGAAAGTGGAGATACTCGAGTATCTCCACTTTCTGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032368.3-638s1c1
Sequence:CCGGGCCAGTTTGAGAAAGTCTCTACTCGAGTAGAGACTTTCTCAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032368.3-214s1c1
Sequence:CCGGGATAGACTCATGCAACAATTACTCGAGTAATTGTTGCATGAGTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032368.3-301s1c1
Sequence:CCGGCTGGAGCAACTAAGTGAATTTCTCGAGAAATTCACTTAGTTGCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032368
VALIDATED
LZIC MISSION shRNA Lentiviral Transduction Particles
leucine zipper and CTNNBIP1 domain containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107735    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032368.3-1122s1c1
Sequence:CCGGGCAAGCTCAATAGACTTCATACTCGAGTATGAAGTCTATTGAGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_032368.3-535s1c1
Sequence:CCGGACTCAACAGAAAGTGGAGATACTCGAGTATCTCCACTTTCTGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032368.3-638s1c1
Sequence:CCGGGCCAGTTTGAGAAAGTCTCTACTCGAGTAGAGACTTTCTCAAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_032368.3-214s1c1
Sequence:CCGGGATAGACTCATGCAACAATTACTCGAGTAATTGTTGCATGAGTCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_032368.3-301s1c1
Sequence:CCGGCTGGAGCAACTAAGTGAATTTCTCGAGAAATTCACTTAGTTGCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026963
VALIDATED
LZIC MISSION shRNA Bacterial Glycerol Stock
leucine zipper and CTNNBIP1 domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026963.2-1638s1c1
Sequence:CCGGCCAAGACTTAGCACTTGTGATCTCGAGATCACAAGTGCTAAGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026963.2-957s1c1
Sequence:CCGGCATCAGATTGTTTGCGAAGAACTCGAGTTCTTCGCAAACAATCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026963.2-846s1c1
Sequence:CCGGCGATTCGCTGAAGAAGATTATCTCGAGATAATCTTCTTCAGCGAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026963.2-840s1c1
Sequence:CCGGGTTCAACGATTCGCTGAAGAACTCGAGTTCTTCAGCGAATCGTTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026963.2-739s1c1
Sequence:CCGGAGACTGATGCAGCAGTTACAACTCGAGTTGTAACTGCTGCATCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026963
VALIDATED
LZIC MISSION shRNA shRNA Plasmid DNA
leucine zipper and CTNNBIP1 domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026963.2-1638s1c1
Sequence:CCGGCCAAGACTTAGCACTTGTGATCTCGAGATCACAAGTGCTAAGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026963.2-957s1c1
Sequence:CCGGCATCAGATTGTTTGCGAAGAACTCGAGTTCTTCGCAAACAATCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026963.2-846s1c1
Sequence:CCGGCGATTCGCTGAAGAAGATTATCTCGAGATAATCTTCTTCAGCGAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026963.2-840s1c1
Sequence:CCGGGTTCAACGATTCGCTGAAGAACTCGAGTTCTTCAGCGAATCGTTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026963.2-739s1c1
Sequence:CCGGAGACTGATGCAGCAGTTACAACTCGAGTTGTAACTGCTGCATCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026963
VALIDATED
LZIC MISSION shRNA Lentiviral Transduction Particles
leucine zipper and CTNNBIP1 domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026963.2-1638s1c1
Sequence:CCGGCCAAGACTTAGCACTTGTGATCTCGAGATCACAAGTGCTAAGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026963.2-957s1c1
Sequence:CCGGCATCAGATTGTTTGCGAAGAACTCGAGTTCTTCGCAAACAATCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026963.2-846s1c1
Sequence:CCGGCGATTCGCTGAAGAAGATTATCTCGAGATAATCTTCTTCAGCGAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026963.2-840s1c1
Sequence:CCGGGTTCAACGATTCGCTGAAGAACTCGAGTTCTTCAGCGAATCGTTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026963.2-739s1c1
Sequence:CCGGAGACTGATGCAGCAGTTACAACTCGAGTTGTAACTGCTGCATCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)