EMAIL THIS PAGE TO A FRIEND

LZTR1

leucine-zipper-like transcription regulator 1

68 Gene Product Result for
Synonyms: BTBD29 LZTR-1
UniProtKB ID: Q8N653, Q14776, Q20WK0
Gene ID:
Human(8216) Summary: This gene encodes a member of the BTB-kelch superfamily. Initially described as a putative transcriptional regulator based on weak homology to members of the basic leucine zipper-like family, the encoded protein subsequently has been shown to localize exclusively to the Golgi network where it may help stabilize the Gogli complex. Deletion of this gene may be associated with DiGeorge syndrome. [provided by RefSeq, Jul 2008]
Mouse(66863) leucine-zipper-like transcriptional regulator, 1
Rat(360745) leucine-zipper-like transcription regulator 1
Zebrafish(792832) leucine-zipper-like transcription regulator 1
cow(506776) leucine-zipper-like transcription regulator 1
Horse(100050778) leucine-zipper-like transcription regulator 1
domestic cat(101084238) leucine-zipper-like transcription regulator 1
dog(608108) leucine-zipper-like transcription regulator 1
chicken(421166) leucine-zipper-like transcription regulator 1
domestic guinea pig(100724888) leucine-zipper-like transcription regulator 1
naked mole-rat(101703765) leucine-zipper-like transcription regulator 1
Domestic Rabbit(100347953) leucine-zipper-like transcription regulator 1
sheep(101117792) leucine-zipper-like transcription regulator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006767 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006767 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006767 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080911 MISSION® esiRNA esiRNA targeting mouse Lztr1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006767 Rosetta Predictions human pricing
NM_001108326 Rosetta Predictions rat pricing
NM_025808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128231 predicted 857
2 SASI_Hs01_00128232 predicted 2089
3 SASI_Hs01_00128233 predicted 353
4 SASI_Hs01_00128234 predicted 2029
5 SASI_Hs01_00128235 predicted 2478
6 SASI_Hs01_00128236 predicted 809
7 SASI_Hs01_00128237 predicted 1032
8 SASI_Hs01_00128238 predicted 1183
9 SASI_Hs01_00128240 predicted 1698
10 SASI_Hs02_00342273 predicted 1903
11 SASI_Hs01_00128239 predicted 1826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237559 predicted 247
2 SASI_Rn02_00237560 predicted 1109
3 SASI_Rn02_00237561 predicted 1109
4 SASI_Rn02_00237562 predicted 246
5 SASI_Rn02_00237563 predicted 1657
6 SASI_Rn02_00237564 predicted 1839
7 SASI_Rn02_00237565 predicted 2417
8 SASI_Rn02_00237566 predicted 1068
9 SASI_Rn02_00237567 predicted 964
10 SASI_Rn02_00237568 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163185 predicted 1603
2 SASI_Mm01_00163187 predicted 271
3 SASI_Mm01_00163188 predicted 970
4 SASI_Mm01_00163189 predicted 2418
5 SASI_Mm02_00329051 predicted 1125
6 SASI_Mm01_00163190 predicted 1826
7 SASI_Mm01_00163191 predicted 608
8 SASI_Mm01_00163192 predicted 459
9 SASI_Mm01_00163193 predicted 2399
10 SASI_Mm01_00163194 predicted 1852
11 SASI_Mm01_00163186 predicted 1129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025808
VALIDATED
LZTR1 MISSION shRNA Bacterial Glycerol Stock
leucine-zipper-like transcription regulator 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-1326s21c1
Sequence:CCGGGTGCACACTGCACGAAGATTACTCGAGTAATCTTCGTGCAGTGTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-756s21c1
Sequence:CCGGCCGGGATAAGATGTTCGTGTTCTCGAGAACACGAACATCTTATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-970s21c1
Sequence:CCGGCCCAATGAGTTGCACTGCTATCTCGAGATAGCAGTGCAACTCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-2283s21c1
Sequence:CCGGCCCGTACTATTACGGCTTCTACTCGAGTAGAAGCCGTAATAGTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-2952s21c1
Sequence:CCGGGCCTCCAGATAGGTACAGATACTCGAGTATCTGTACCTATCTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025808.2-2952s1c1
Sequence:CCGGGCCTCCAGATAGGTACAGATACTCGAGTATCTGTACCTATCTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025808.2-970s1c1
Sequence:CCGGCCCAATGAGTTGCACTGCTATCTCGAGATAGCAGTGCAACTCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025808.2-756s1c1
Sequence:CCGGCCGGGATAAGATGTTCGTGTTCTCGAGAACACGAACATCTTATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025808.2-2283s1c1
Sequence:CCGGCCCGTACTATTACGGCTTCTACTCGAGTAGAAGCCGTAATAGTACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025808.2-267s1c1
Sequence:CCGGCGTGGCATATAAGGATGCCATCTCGAGATGGCATCCTTATATGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025808
VALIDATED
LZTR1 MISSION shRNA shRNA Plasmid DNA
leucine-zipper-like transcription regulator 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-1326s21c1
Sequence:CCGGGTGCACACTGCACGAAGATTACTCGAGTAATCTTCGTGCAGTGTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-756s21c1
Sequence:CCGGCCGGGATAAGATGTTCGTGTTCTCGAGAACACGAACATCTTATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-970s21c1
Sequence:CCGGCCCAATGAGTTGCACTGCTATCTCGAGATAGCAGTGCAACTCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-2283s21c1
Sequence:CCGGCCCGTACTATTACGGCTTCTACTCGAGTAGAAGCCGTAATAGTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-2952s21c1
Sequence:CCGGGCCTCCAGATAGGTACAGATACTCGAGTATCTGTACCTATCTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025808.2-2952s1c1
Sequence:CCGGGCCTCCAGATAGGTACAGATACTCGAGTATCTGTACCTATCTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025808.2-970s1c1
Sequence:CCGGCCCAATGAGTTGCACTGCTATCTCGAGATAGCAGTGCAACTCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025808.2-756s1c1
Sequence:CCGGCCGGGATAAGATGTTCGTGTTCTCGAGAACACGAACATCTTATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025808.2-2283s1c1
Sequence:CCGGCCCGTACTATTACGGCTTCTACTCGAGTAGAAGCCGTAATAGTACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025808.2-267s1c1
Sequence:CCGGCGTGGCATATAAGGATGCCATCTCGAGATGGCATCCTTATATGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025808
VALIDATED
LZTR1 MISSION shRNA Lentiviral Transduction Particles
leucine-zipper-like transcription regulator 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-1326s21c1
Sequence:CCGGGTGCACACTGCACGAAGATTACTCGAGTAATCTTCGTGCAGTGTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-756s21c1
Sequence:CCGGCCGGGATAAGATGTTCGTGTTCTCGAGAACACGAACATCTTATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-970s21c1
Sequence:CCGGCCCAATGAGTTGCACTGCTATCTCGAGATAGCAGTGCAACTCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-2283s21c1
Sequence:CCGGCCCGTACTATTACGGCTTCTACTCGAGTAGAAGCCGTAATAGTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287310    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025808.3-2952s21c1
Sequence:CCGGGCCTCCAGATAGGTACAGATACTCGAGTATCTGTACCTATCTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103740    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025808.2-2952s1c1
Sequence:CCGGGCCTCCAGATAGGTACAGATACTCGAGTATCTGTACCTATCTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025808.2-970s1c1
Sequence:CCGGCCCAATGAGTTGCACTGCTATCTCGAGATAGCAGTGCAACTCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025808.2-756s1c1
Sequence:CCGGCCGGGATAAGATGTTCGTGTTCTCGAGAACACGAACATCTTATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025808.2-2283s1c1
Sequence:CCGGCCCGTACTATTACGGCTTCTACTCGAGTAGAAGCCGTAATAGTACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025808.2-267s1c1
Sequence:CCGGCGTGGCATATAAGGATGCCATCTCGAGATGGCATCCTTATATGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006767
VALIDATED
LZTR1 MISSION shRNA Bacterial Glycerol Stock
leucine-zipper-like transcription regulator 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006767.3-477s21c1
Sequence:CCGGTCTATGGGAGCAGCATGTTTGCTCGAGCAAACATGCTGCTCCCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006767.3-314s21c1
Sequence:CCGGCACACAGTGGTGGCCTATAAACTCGAGTTTATAGGCCACCACTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006767.3-1362s21c1
Sequence:CCGGAGTTCTCCTGTTACCCTAAATCTCGAGATTTAGGGTAACAGGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006767.3-654s21c1
Sequence:CCGGGTGACAAGCTGTGGATCTTTGCTCGAGCAAAGATCCACAGCTTGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006767.3-3331s21c1
Sequence:CCGGCCGTGTCCCTTGCTGAGTATTCTCGAGAATACTCAGCAAGGGACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006767.1-1069s1c1
Sequence:CCGGCTTCAAGAAGTCCCGAGATGTCTCGAGACATCTCGGGACTTCTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006767.1-1085s1c1
Sequence:CCGGGATGTGTTTGGCCTGGACTTTCTCGAGAAAGTCCAGGCCAAACACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006767.1-2377s1c1
Sequence:CCGGGCACATCATTGTGCACCAGTTCTCGAGAACTGGTGCACAATGATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006767.1-1591s1c1
Sequence:CCGGCAAGATCAAATACCCACGGAACTCGAGTTCCGTGGGTATTTGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006767
VALIDATED
LZTR1 MISSION shRNA shRNA Plasmid DNA
leucine-zipper-like transcription regulator 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006767.3-477s21c1
Sequence:CCGGTCTATGGGAGCAGCATGTTTGCTCGAGCAAACATGCTGCTCCCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006767.3-314s21c1
Sequence:CCGGCACACAGTGGTGGCCTATAAACTCGAGTTTATAGGCCACCACTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006767.3-1362s21c1
Sequence:CCGGAGTTCTCCTGTTACCCTAAATCTCGAGATTTAGGGTAACAGGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006767.3-654s21c1
Sequence:CCGGGTGACAAGCTGTGGATCTTTGCTCGAGCAAAGATCCACAGCTTGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006767.3-3331s21c1
Sequence:CCGGCCGTGTCCCTTGCTGAGTATTCTCGAGAATACTCAGCAAGGGACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006767.1-1069s1c1
Sequence:CCGGCTTCAAGAAGTCCCGAGATGTCTCGAGACATCTCGGGACTTCTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006767.1-1085s1c1
Sequence:CCGGGATGTGTTTGGCCTGGACTTTCTCGAGAAAGTCCAGGCCAAACACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006767.1-2377s1c1
Sequence:CCGGGCACATCATTGTGCACCAGTTCTCGAGAACTGGTGCACAATGATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006767.1-1591s1c1
Sequence:CCGGCAAGATCAAATACCCACGGAACTCGAGTTCCGTGGGTATTTGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006767
VALIDATED
LZTR1 MISSION shRNA Lentiviral Transduction Particles
leucine-zipper-like transcription regulator 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006767.3-477s21c1
Sequence:CCGGTCTATGGGAGCAGCATGTTTGCTCGAGCAAACATGCTGCTCCCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006767.3-314s21c1
Sequence:CCGGCACACAGTGGTGGCCTATAAACTCGAGTTTATAGGCCACCACTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006767.3-1362s21c1
Sequence:CCGGAGTTCTCCTGTTACCCTAAATCTCGAGATTTAGGGTAACAGGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006767.3-654s21c1
Sequence:CCGGGTGACAAGCTGTGGATCTTTGCTCGAGCAAAGATCCACAGCTTGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006767.3-3331s21c1
Sequence:CCGGCCGTGTCCCTTGCTGAGTATTCTCGAGAATACTCAGCAAGGGACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006767.1-1069s1c1
Sequence:CCGGCTTCAAGAAGTCCCGAGATGTCTCGAGACATCTCGGGACTTCTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006767.1-1085s1c1
Sequence:CCGGGATGTGTTTGGCCTGGACTTTCTCGAGAAAGTCCAGGCCAAACACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006767.1-2377s1c1
Sequence:CCGGGCACATCATTGTGCACCAGTTCTCGAGAACTGGTGCACAATGATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178953    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006767.1-1591s1c1
Sequence:CCGGCAAGATCAAATACCCACGGAACTCGAGTTCCGTGGGTATTTGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)