EMAIL THIS PAGE TO A FRIEND

LZTS1

leucine zipper, putative tumor suppressor 1

75 Gene Product Result for
Synonyms: F37 FEZ1
Gene ID:
Human(11178) Summary: This gene encodes a tumor suppressor protein that is ubiquitously expressed in normal tissues. In uveal melanomas, expression of this protein is silenced in rapidly metastasizing and metastatic tumor cells but has normal expression in slowly metastasizing or nonmetastasizing tumor cells. This protein may have a role in cell-cycle control by interacting with the Cdk1/cyclinB1 complex. This gene is located on chromosomal region 8p22. Loss of heterozygosity (LOH) in the 8p arm is a common characteristic of many types of cancer. [provided by RefSeq, Nov 2009]
Mouse(211134) leucine zipper, putative tumor suppressor 1
Rat(266711) leucine zipper, putative tumor suppressor 1
sheep(101120987) leucine zipper, putative tumor suppressor 1
naked mole-rat(101704547) leucine zipper, putative tumor suppressor 1
domestic guinea pig(100726802) leucine zipper, putative tumor suppressor 1
Zebrafish(569281) leucine zipper, putative tumor suppressor 1
cow(539634) leucine zipper, putative tumor suppressor 1
Horse(100053630) leucine zipper, putative tumor suppressor 1
domestic cat(101092354) leucine zipper, putative tumor suppressor 1
dog(486136) leucine zipper, putative tumor suppressor 1
chicken(431331) leucine zipper, putative tumor suppressor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021020 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU024831 MISSION® esiRNA esiRNA targeting mouse Lzts1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021020 Rosetta Predictions human pricing
NM_153470 Rosetta Predictions rat pricing
NM_199364 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031519 predicted 2292
2 SASI_Hs01_00031520 predicted 438
3 SASI_Hs01_00031521 predicted 2348
4 SASI_Hs01_00031522 predicted 2252
5 SASI_Hs01_00031523 predicted 1876
6 SASI_Hs01_00031524 predicted 1344
7 SASI_Hs01_00031525 predicted 2184
8 SASI_Hs01_00031526 predicted 1720
9 SASI_Hs01_00031527 predicted 1334
10 SASI_Hs01_00031528 predicted 2148
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153470 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060675 predicted 677
2 SASI_Rn01_00060676 predicted 1490
3 SASI_Rn01_00060677 predicted 987
4 SASI_Rn01_00060678 predicted 667
5 SASI_Rn01_00060679 predicted 1189
6 SASI_Rn01_00060680 predicted 521
7 SASI_Rn01_00060681 predicted 647
8 SASI_Rn01_00060682 predicted 1965
9 SASI_Rn02_00268982 predicted 412
10 SASI_Rn02_00268983 predicted 1498
11 SASI_Rn01_00060683 predicted 995
12 SASI_Rn01_00060684 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075161 predicted 303
2 SASI_Mm01_00075162 predicted 1145
3 SASI_Mm01_00075163 predicted 1382
4 SASI_Mm02_00351459 predicted 1190
5 SASI_Mm01_00075164 predicted 675
6 SASI_Mm01_00075165 predicted 565
7 SASI_Mm01_00075167 predicted 1181
8 SASI_Mm01_00075168 predicted 764
9 SASI_Mm01_00075170 predicted 852
10 SASI_Mm02_00351460 predicted 443
11 SASI_Mm01_00075166 predicted 843
12 SASI_Mm01_00075169 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021020
LZTS1 MISSION shRNA Bacterial Glycerol Stock
leucine zipper, putative tumor suppressor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021020.1-2175s1c1
Sequence:CCGGCCCTAAACTTTGGCCTTTGTTCTCGAGAACAAAGGCCAAAGTTTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021020.1-774s1c1
Sequence:CCGGCAGCAACATGATGAGCCTGAACTCGAGTTCAGGCTCATCATGTTGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021020.1-309s1c1
Sequence:CCGGCTACATCAAGGTCAGCCAGAACTCGAGTTCTGGCTGACCTTGATGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021020.1-831s1c1
Sequence:CCGGCCACTCGAACAAGGCAGACAACTCGAGTTGTCTGCCTTGTTCGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021020.1-434s1c1
Sequence:CCGGCCTTCTCCAATCAGCTAGAAACTCGAGTTTCTAGCTGATTGGAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021020.2-2356s21c1
Sequence:CCGGCCATCAGAACCTGAGCTATTTCTCGAGAAATAGCTCAGGTTCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021020.2-1724s21c1
Sequence:CCGGAGGTGATTCAGTACCAGAAACCTCGAGGTTTCTGGTACTGAATCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021020.2-2295s21c1
Sequence:CCGGACATTGGAATGCCTTGGAAATCTCGAGATTTCCAAGGCATTCCAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021020.2-204s21c1
Sequence:CCGGCAAGAAGCTCAACCGGTATTCCTCGAGGAATACCGGTTGAGCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021020
LZTS1 MISSION shRNA shRNA Plasmid DNA
leucine zipper, putative tumor suppressor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021020.1-2175s1c1
Sequence:CCGGCCCTAAACTTTGGCCTTTGTTCTCGAGAACAAAGGCCAAAGTTTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021020.1-774s1c1
Sequence:CCGGCAGCAACATGATGAGCCTGAACTCGAGTTCAGGCTCATCATGTTGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021020.1-309s1c1
Sequence:CCGGCTACATCAAGGTCAGCCAGAACTCGAGTTCTGGCTGACCTTGATGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021020.1-831s1c1
Sequence:CCGGCCACTCGAACAAGGCAGACAACTCGAGTTGTCTGCCTTGTTCGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021020.1-434s1c1
Sequence:CCGGCCTTCTCCAATCAGCTAGAAACTCGAGTTTCTAGCTGATTGGAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021020.2-2356s21c1
Sequence:CCGGCCATCAGAACCTGAGCTATTTCTCGAGAAATAGCTCAGGTTCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021020.2-1724s21c1
Sequence:CCGGAGGTGATTCAGTACCAGAAACCTCGAGGTTTCTGGTACTGAATCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021020.2-2295s21c1
Sequence:CCGGACATTGGAATGCCTTGGAAATCTCGAGATTTCCAAGGCATTCCAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021020.2-204s21c1
Sequence:CCGGCAAGAAGCTCAACCGGTATTCCTCGAGGAATACCGGTTGAGCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021020
LZTS1 MISSION shRNA Lentiviral Transduction Particles
leucine zipper, putative tumor suppressor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021020.1-2175s1c1
Sequence:CCGGCCCTAAACTTTGGCCTTTGTTCTCGAGAACAAAGGCCAAAGTTTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021020.1-774s1c1
Sequence:CCGGCAGCAACATGATGAGCCTGAACTCGAGTTCAGGCTCATCATGTTGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021020.1-309s1c1
Sequence:CCGGCTACATCAAGGTCAGCCAGAACTCGAGTTCTGGCTGACCTTGATGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021020.1-831s1c1
Sequence:CCGGCCACTCGAACAAGGCAGACAACTCGAGTTGTCTGCCTTGTTCGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021020.1-434s1c1
Sequence:CCGGCCTTCTCCAATCAGCTAGAAACTCGAGTTTCTAGCTGATTGGAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021020.2-2356s21c1
Sequence:CCGGCCATCAGAACCTGAGCTATTTCTCGAGAAATAGCTCAGGTTCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021020.2-1724s21c1
Sequence:CCGGAGGTGATTCAGTACCAGAAACCTCGAGGTTTCTGGTACTGAATCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021020.2-2295s21c1
Sequence:CCGGACATTGGAATGCCTTGGAAATCTCGAGATTTCCAAGGCATTCCAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021020.2-204s21c1
Sequence:CCGGCAAGAAGCTCAACCGGTATTCCTCGAGGAATACCGGTTGAGCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199364
LZTS1 MISSION shRNA Bacterial Glycerol Stock
leucine zipper, putative tumor suppressor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-186s1c1
Sequence:CCGGCGAAGACTTCTTCTACATCAACTCGAGTTGATGTAGAAGAAGTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-1360s1c1
Sequence:CCGGCGCAAGAAGAATGAGGCAGAACTCGAGTTCTGCCTCATTCTTCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-323s1c1
Sequence:CCGGCCTTCTCCAATCAACTGGAAACTCGAGTTTCCAGTTGATTGGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-1196s1c1
Sequence:CCGGCCCAATTAGAGGTGAACACTACTCGAGTAGTGTTCACCTCTAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-153s1c1
Sequence:CCGGCCGTGGAAAGTCAAGTTCCAACTCGAGTTGGAACTTGACTTTCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199364
LZTS1 MISSION shRNA shRNA Plasmid DNA
leucine zipper, putative tumor suppressor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-186s1c1
Sequence:CCGGCGAAGACTTCTTCTACATCAACTCGAGTTGATGTAGAAGAAGTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-1360s1c1
Sequence:CCGGCGCAAGAAGAATGAGGCAGAACTCGAGTTCTGCCTCATTCTTCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-323s1c1
Sequence:CCGGCCTTCTCCAATCAACTGGAAACTCGAGTTTCCAGTTGATTGGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-1196s1c1
Sequence:CCGGCCCAATTAGAGGTGAACACTACTCGAGTAGTGTTCACCTCTAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-153s1c1
Sequence:CCGGCCGTGGAAAGTCAAGTTCCAACTCGAGTTGGAACTTGACTTTCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199364
LZTS1 MISSION shRNA Lentiviral Transduction Particles
leucine zipper, putative tumor suppressor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-186s1c1
Sequence:CCGGCGAAGACTTCTTCTACATCAACTCGAGTTGATGTAGAAGAAGTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-1360s1c1
Sequence:CCGGCGCAAGAAGAATGAGGCAGAACTCGAGTTCTGCCTCATTCTTCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-323s1c1
Sequence:CCGGCCTTCTCCAATCAACTGGAAACTCGAGTTTCCAGTTGATTGGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-1196s1c1
Sequence:CCGGCCCAATTAGAGGTGAACACTACTCGAGTAGTGTTCACCTCTAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199364.1-153s1c1
Sequence:CCGGCCGTGGAAAGTCAAGTTCCAACTCGAGTTGGAACTTGACTTTCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)