EMAIL THIS PAGE TO A FRIEND

LZTS2

leucine zipper, putative tumor suppressor 2

189 Gene Product Result for
Synonyms: LAPSER1
UniProtKB ID: Q9BRK4, B1AL14, D3DR72, Q8N3I0, Q96J79, Q96JL2
Gene ID:
Mouse(226154) leucine zipper, putative tumor suppressor 2
Rat(365468) leucine zipper, putative tumor suppressor 2
chicken(428973) leucine zipper, putative tumor suppressor 2
domestic cat(101094378) leucine zipper, putative tumor suppressor 2
dog(486846) leucine zipper, putative tumor suppressor 2
Horse(100060415) leucine zipper, putative tumor suppressor 2
cow(504411) leucine zipper, putative tumor suppressor 2
domestic guinea pig(100732685) leucine zipper, putative tumor suppressor 2
naked mole-rat(101722524) leucine zipper, putative tumor suppressor 2
Goat(100861067) leucine zipper, putative tumor suppressor 2
sheep(101112180) leucine zipper, putative tumor suppressor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032429 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032429 Rosetta Predictions human pricing
NM_001014247 Rosetta Predictions rat pricing
NM_001130525 Rosetta Predictions mouse pricing
NM_001130526 Rosetta Predictions mouse pricing
NM_145503 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101245 predicted 2289
2 SASI_Hs01_00101246 predicted 2181
3 SASI_Hs01_00101247 predicted 1709
4 SASI_Hs01_00101248 predicted 323
5 SASI_Hs02_00359835 predicted 2479
6 SASI_Hs01_00101249 predicted 2252
7 SASI_Hs01_00101250 predicted 1718
8 SASI_Hs01_00101251 predicted 2305
9 SASI_Hs01_00101252 predicted 2306
10 SASI_Hs01_00101253 predicted 2050
11 SASI_Hs01_00101254 predicted 1270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094732 predicted 1433
2 SASI_Rn01_00094733 predicted 1832
3 SASI_Rn01_00094734 predicted 1357
4 SASI_Rn02_00201810 predicted 1814
5 SASI_Rn01_00094735 predicted 1578
6 SASI_Rn01_00094736 predicted 1705
7 SASI_Rn01_00094737 predicted 1710
8 SASI_Rn01_00094738 predicted 827
9 SASI_Rn01_00094739 predicted 1568
10 SASI_Rn01_00094741 predicted 1242
11 SASI_Rn01_00094740 predicted 1848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311370 predicted 1464
2 SASI_Mm02_00311371 predicted 2086
3 SASI_Mm02_00311372 predicted 1864
4 SASI_Mm02_00311373 predicted 2248
5 SASI_Mm02_00311374 predicted 473
6 SASI_Mm02_00311375 predicted 1351
7 SASI_Mm02_00311376 predicted 933
8 SASI_Mm02_00311377 predicted 1813
9 SASI_Mm02_00311378 predicted 1732
10 SASI_Mm02_00311379 predicted 2321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311380 predicted 1458
2 SASI_Mm02_00311381 predicted 2078
3 SASI_Mm02_00311382 predicted 1864
4 SASI_Mm02_00311383 predicted 2244
5 SASI_Mm02_00311384 predicted 461
6 SASI_Mm02_00311385 predicted 1346
7 SASI_Mm02_00311386 predicted 930
8 SASI_Mm02_00311387 predicted 1799
9 SASI_Mm02_00311388 predicted 1727
10 SASI_Mm02_00311389 predicted 2318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042934 predicted 1505
2 SASI_Mm01_00042935 predicted 2133
3 SASI_Mm01_00042936 predicted 1916
4 SASI_Mm01_00042937 predicted 2297
5 SASI_Mm01_00042938 predicted 516
6 SASI_Mm01_00042939 predicted 1399
7 SASI_Mm01_00042940 predicted 977
8 SASI_Mm01_00042941 predicted 1851
9 SASI_Mm01_00042942 predicted 1778
10 SASI_Mm01_00042943 predicted 2366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145503
LZTS2 MISSION shRNA Bacterial Glycerol Stock
leucine zipper, putative tumor suppressor 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145503.2-600s21c1
Sequence:CCGGATATGGAGAAGATCCTGATCCCTCGAGGGATCAGGATCTTCTCCATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145503.1-702s1c1
Sequence:CCGGCCGAAATTCTTTATCCAGCTTCTCGAGAAGCTGGATAAAGAATTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145503.1-289s1c1
Sequence:CCGGCCAGGCAATAGCTTTACCTATCTCGAGATAGGTAAAGCTATTGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145503.1-2479s1c1
Sequence:CCGGCCCAGCAATGTCTTGTTTATTCTCGAGAATAAACAAGACATTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145503.1-1249s1c1
Sequence:CCGGCGCCAGTTGCAGGATGACTTTCTCGAGAAAGTCATCCTGCAACTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145503.1-1899s1c1
Sequence:CCGGGCACAACTATATCCAGATGTACTCGAGTACATCTGGATATAGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145503
LZTS2 MISSION shRNA shRNA Plasmid DNA
leucine zipper, putative tumor suppressor 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145503.2-600s21c1
Sequence:CCGGATATGGAGAAGATCCTGATCCCTCGAGGGATCAGGATCTTCTCCATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145503.1-702s1c1
Sequence:CCGGCCGAAATTCTTTATCCAGCTTCTCGAGAAGCTGGATAAAGAATTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145503.1-289s1c1
Sequence:CCGGCCAGGCAATAGCTTTACCTATCTCGAGATAGGTAAAGCTATTGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145503.1-2479s1c1
Sequence:CCGGCCCAGCAATGTCTTGTTTATTCTCGAGAATAAACAAGACATTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145503.1-1249s1c1
Sequence:CCGGCGCCAGTTGCAGGATGACTTTCTCGAGAAAGTCATCCTGCAACTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145503.1-1899s1c1
Sequence:CCGGGCACAACTATATCCAGATGTACTCGAGTACATCTGGATATAGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145503
LZTS2 MISSION shRNA Lentiviral Transduction Particles
leucine zipper, putative tumor suppressor 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145503.2-600s21c1
Sequence:CCGGATATGGAGAAGATCCTGATCCCTCGAGGGATCAGGATCTTCTCCATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145503.1-702s1c1
Sequence:CCGGCCGAAATTCTTTATCCAGCTTCTCGAGAAGCTGGATAAAGAATTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145503.1-289s1c1
Sequence:CCGGCCAGGCAATAGCTTTACCTATCTCGAGATAGGTAAAGCTATTGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145503.1-2479s1c1
Sequence:CCGGCCCAGCAATGTCTTGTTTATTCTCGAGAATAAACAAGACATTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145503.1-1249s1c1
Sequence:CCGGCGCCAGTTGCAGGATGACTTTCTCGAGAAAGTCATCCTGCAACTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145503.1-1899s1c1
Sequence:CCGGGCACAACTATATCCAGATGTACTCGAGTACATCTGGATATAGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032429
LZTS2 MISSION shRNA Bacterial Glycerol Stock
leucine zipper, putative tumor suppressor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032429.1-1911s21c1
Sequence:CCGGGAAGCAGCTGCAGCACAACTACTCGAGTAGTTGTGCTGCAGCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032429.1-2259s21c1
Sequence:CCGGGCAAGATCAGACCGCTCAAAGCTCGAGCTTTGAGCGGTCTGATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-459s1c1
Sequence:CCGGCTCTGGAAAGCTGGAGAAGAACTCGAGTTCTTCTCCAGCTTTCCAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-2058s1c1
Sequence:CCGGGATCACTGCTACTGAGATCTACTCGAGTAGATCTCAGTAGCAGTGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-717s1c1
Sequence:CCGGGCTATCCGACTCTGGCCGAAACTCGAGTTTCGGCCAGAGTCGGATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-1726s1c1
Sequence:CCGGGCAGAGAGTGATGAGGCCAAACTCGAGTTTGGCCTCATCACTCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-376s1c1
Sequence:CCGGCCAAGCAGTGATGTTGAGGATCTCGAGATCCTCAACATCACTGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032429
LZTS2 MISSION shRNA shRNA Plasmid DNA
leucine zipper, putative tumor suppressor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032429.1-1911s21c1
Sequence:CCGGGAAGCAGCTGCAGCACAACTACTCGAGTAGTTGTGCTGCAGCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032429.1-2259s21c1
Sequence:CCGGGCAAGATCAGACCGCTCAAAGCTCGAGCTTTGAGCGGTCTGATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-459s1c1
Sequence:CCGGCTCTGGAAAGCTGGAGAAGAACTCGAGTTCTTCTCCAGCTTTCCAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-2058s1c1
Sequence:CCGGGATCACTGCTACTGAGATCTACTCGAGTAGATCTCAGTAGCAGTGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-717s1c1
Sequence:CCGGGCTATCCGACTCTGGCCGAAACTCGAGTTTCGGCCAGAGTCGGATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-1726s1c1
Sequence:CCGGGCAGAGAGTGATGAGGCCAAACTCGAGTTTGGCCTCATCACTCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-376s1c1
Sequence:CCGGCCAAGCAGTGATGTTGAGGATCTCGAGATCCTCAACATCACTGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032429
LZTS2 MISSION shRNA Lentiviral Transduction Particles
leucine zipper, putative tumor suppressor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032429.1-1911s21c1
Sequence:CCGGGAAGCAGCTGCAGCACAACTACTCGAGTAGTTGTGCTGCAGCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032429.1-2259s21c1
Sequence:CCGGGCAAGATCAGACCGCTCAAAGCTCGAGCTTTGAGCGGTCTGATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-459s1c1
Sequence:CCGGCTCTGGAAAGCTGGAGAAGAACTCGAGTTCTTCTCCAGCTTTCCAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-2058s1c1
Sequence:CCGGGATCACTGCTACTGAGATCTACTCGAGTAGATCTCAGTAGCAGTGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-717s1c1
Sequence:CCGGGCTATCCGACTCTGGCCGAAACTCGAGTTTCGGCCAGAGTCGGATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-1726s1c1
Sequence:CCGGGCAGAGAGTGATGAGGCCAAACTCGAGTTTGGCCTCATCACTCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032429.1-376s1c1
Sequence:CCGGCCAAGCAGTGATGTTGAGGATCTCGAGATCCTCAACATCACTGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)