EMAIL THIS PAGE TO A FRIEND

LZTS3

111 Gene Product Result for
Synonyms: PROSAPIP1
UniProtKB ID: O60299, A2A2Q7, D3DVX6, Q8IXX8
Gene ID:
Mouse(241638) leucine zipper, putative tumor suppressor family member 3
Rat(280670) leucine zipper, putative tumor suppressor family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014731 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_197945 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197945 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197945 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014731 Rosetta Predictions human pricing
NM_172022 Rosetta Predictions rat pricing
NM_197945 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010211 predicted 2144
2 SASI_Hs01_00010212 predicted 1977
3 SASI_Hs01_00010213 predicted 1768
4 SASI_Hs01_00010214 predicted 3723
5 SASI_Hs01_00010215 predicted 2036
6 SASI_Hs01_00010216 predicted 1669
7 SASI_Hs01_00010217 predicted 2127
8 SASI_Hs01_00010218 predicted 2771
9 SASI_Hs01_00010219 predicted 1992
10 SASI_Hs02_00346175 predicted 2557
11 SASI_Hs01_00010220 predicted 1848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172022 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051114 predicted 2088
2 SASI_Rn02_00269110 predicted 842
3 SASI_Rn02_00269111 predicted 766
4 SASI_Rn01_00051116 predicted 773
5 SASI_Rn01_00051117 predicted 1269
6 SASI_Rn02_00269112 predicted 1409
7 SASI_Rn01_00051118 predicted 756
8 SASI_Rn01_00051119 predicted 739
9 SASI_Rn01_00051120 predicted 1401
10 SASI_Rn01_00051121 predicted 1360
11 SASI_Rn01_00051115 predicted 842
12 SASI_Rn01_00051122 predicted 1467
13 SASI_Rn01_00051123 predicted 1319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197945 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116800 predicted 1588
2 SASI_Mm01_00116801 predicted 2328
3 SASI_Mm02_00350654 predicted 275
4 SASI_Mm01_00116804 predicted 2270
5 SASI_Mm01_00116805 predicted 1010
6 SASI_Mm01_00116808 predicted 1479
7 SASI_Mm02_00350655 predicted 1561
8 SASI_Mm02_00350656 predicted 1562
9 SASI_Mm02_00350657 predicted 1006
10 SASI_Mm02_00350658 predicted 234
11 SASI_Mm01_00116802 predicted 2251
12 SASI_Mm01_00116803 predicted 2446
13 SASI_Mm01_00116806 predicted 1428
14 SASI_Mm01_00116807 predicted 1576
15 SASI_Mm01_00116809 predicted 915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014731
VALIDATED
LZTS3 MISSION shRNA Bacterial Glycerol Stock
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-2700s1c1
Sequence:CCGGGATAGAGGAAACTAAGTGGGACTCGAGTCCCACTTAGTTTCCTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-1908s1c1
Sequence:CCGGGAATTTCCACTCCATGCAGAACTCGAGTTCTGCATGGAGTGGAAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014731.2-2696s1c1
Sequence:CCGGCCCGGATAGAGGAAACTAAGTCTCGAGACTTAGTTTCCTCTATCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014731.2-3228s1c1
Sequence:CCGGGAAGGTGATCGAGTACCAGAACTCGAGTTCTGGTACTCGATCACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-3222s1c1
Sequence:CCGGGAAGGAGAAGGTGATCGAGTACTCGAGTACTCGATCACCTTCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014731.2-2790s1c1
Sequence:CCGGGCAGAAGTTGAGTGAGATCGTCTCGAGACGATCTCACTCAACTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014731.2-4364s1c1
Sequence:CCGGGCTCAGCACATCATCTTCCTACTCGAGTAGGAAGATGATGTGCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014731.2-1893s1c1
Sequence:CCGGGCCTGTCGTACCCAAGAATTTCTCGAGAAATTCTTGGGTACGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-3396s1c1
Sequence:CCGGGCGCATTGAGTCCACAGAAATCTCGAGATTTCTGTGGACTCAATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014731.2-4343s1c1
Sequence:CCGGCCAGCCTCTTTCTGCTTTCATCTCGAGATGAAAGCAGAAAGAGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-2787s1c1
Sequence:CCGGGTCGCAGAAGTTGAGTGAGATCTCGAGATCTCACTCAACTTCTGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014731.2-3521s1c1
Sequence:CCGGCCAGACCAAAGAGGTTCTCTACTCGAGTAGAGAACCTCTTTGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014731.2-2790s21c1
Sequence:CCGGGCAGAAGTTGAGTGAGATCGTCTCGAGACGATCTCACTCAACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014731.2-2124s21c1
Sequence:CCGGTGCCTCCACCAGCCACATTAACTCGAGTTAATGTGGCTGGTGGAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014731.2-2251s21c1
Sequence:CCGGAGTGGGTCGTCGTCATCTATGCTCGAGCATAGATGACGACGACCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014731.2-3849s21c1
Sequence:CCGGCTGCACCAGGTTTGCTGAAACCTCGAGGTTTCAGCAAACCTGGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014731
VALIDATED
LZTS3 MISSION shRNA shRNA Plasmid DNA
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-2700s1c1
Sequence:CCGGGATAGAGGAAACTAAGTGGGACTCGAGTCCCACTTAGTTTCCTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-1908s1c1
Sequence:CCGGGAATTTCCACTCCATGCAGAACTCGAGTTCTGCATGGAGTGGAAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014731.2-2696s1c1
Sequence:CCGGCCCGGATAGAGGAAACTAAGTCTCGAGACTTAGTTTCCTCTATCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014731.2-3228s1c1
Sequence:CCGGGAAGGTGATCGAGTACCAGAACTCGAGTTCTGGTACTCGATCACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-3222s1c1
Sequence:CCGGGAAGGAGAAGGTGATCGAGTACTCGAGTACTCGATCACCTTCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014731.2-2790s1c1
Sequence:CCGGGCAGAAGTTGAGTGAGATCGTCTCGAGACGATCTCACTCAACTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014731.2-4364s1c1
Sequence:CCGGGCTCAGCACATCATCTTCCTACTCGAGTAGGAAGATGATGTGCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014731.2-1893s1c1
Sequence:CCGGGCCTGTCGTACCCAAGAATTTCTCGAGAAATTCTTGGGTACGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-3396s1c1
Sequence:CCGGGCGCATTGAGTCCACAGAAATCTCGAGATTTCTGTGGACTCAATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014731.2-4343s1c1
Sequence:CCGGCCAGCCTCTTTCTGCTTTCATCTCGAGATGAAAGCAGAAAGAGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-2787s1c1
Sequence:CCGGGTCGCAGAAGTTGAGTGAGATCTCGAGATCTCACTCAACTTCTGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014731.2-3521s1c1
Sequence:CCGGCCAGACCAAAGAGGTTCTCTACTCGAGTAGAGAACCTCTTTGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014731.2-2790s21c1
Sequence:CCGGGCAGAAGTTGAGTGAGATCGTCTCGAGACGATCTCACTCAACTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014731.2-2124s21c1
Sequence:CCGGTGCCTCCACCAGCCACATTAACTCGAGTTAATGTGGCTGGTGGAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014731.2-2251s21c1
Sequence:CCGGAGTGGGTCGTCGTCATCTATGCTCGAGCATAGATGACGACGACCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014731.2-3849s21c1
Sequence:CCGGCTGCACCAGGTTTGCTGAAACCTCGAGGTTTCAGCAAACCTGGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014731
VALIDATED
LZTS3 MISSION shRNA Lentiviral Transduction Particles
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-2700s1c1
Sequence:CCGGGATAGAGGAAACTAAGTGGGACTCGAGTCCCACTTAGTTTCCTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-1908s1c1
Sequence:CCGGGAATTTCCACTCCATGCAGAACTCGAGTTCTGCATGGAGTGGAAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014731.2-2696s1c1
Sequence:CCGGCCCGGATAGAGGAAACTAAGTCTCGAGACTTAGTTTCCTCTATCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014731.2-3228s1c1
Sequence:CCGGGAAGGTGATCGAGTACCAGAACTCGAGTTCTGGTACTCGATCACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-3222s1c1
Sequence:CCGGGAAGGAGAAGGTGATCGAGTACTCGAGTACTCGATCACCTTCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_014731.2-2790s1c1
Sequence:CCGGGCAGAAGTTGAGTGAGATCGTCTCGAGACGATCTCACTCAACTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014731.2-4364s1c1
Sequence:CCGGGCTCAGCACATCATCTTCCTACTCGAGTAGGAAGATGATGTGCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014731.2-1893s1c1
Sequence:CCGGGCCTGTCGTACCCAAGAATTTCTCGAGAAATTCTTGGGTACGACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-3396s1c1
Sequence:CCGGGCGCATTGAGTCCACAGAAATCTCGAGATTTCTGTGGACTCAATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014731.2-4343s1c1
Sequence:CCGGCCAGCCTCTTTCTGCTTTCATCTCGAGATGAAAGCAGAAAGAGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014731.2-2787s1c1
Sequence:CCGGGTCGCAGAAGTTGAGTGAGATCTCGAGATCTCACTCAACTTCTGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014731.2-3521s1c1
Sequence:CCGGCCAGACCAAAGAGGTTCTCTACTCGAGTAGAGAACCTCTTTGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014731.2-2790s21c1
Sequence:CCGGGCAGAAGTTGAGTGAGATCGTCTCGAGACGATCTCACTCAACTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014731.2-2124s21c1
Sequence:CCGGTGCCTCCACCAGCCACATTAACTCGAGTTAATGTGGCTGGTGGAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014731.2-2251s21c1
Sequence:CCGGAGTGGGTCGTCGTCATCTATGCTCGAGCATAGATGACGACGACCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014731.2-3849s21c1
Sequence:CCGGCTGCACCAGGTTTGCTGAAACCTCGAGGTTTCAGCAAACCTGGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197945
LZTS3 MISSION shRNA Bacterial Glycerol Stock
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197945.2-754s1c1
Sequence:CCGGGTTGTACCCAAGAACTTTCATCTCGAGATGAAAGTTCTTGGGTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197945.2-1903s1c1
Sequence:CCGGGCTTCTCTGGTTTCTGTTGATCTCGAGATCAACAGAAACCAGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197945.2-751s1c2
Sequence:CCGGCCTGTTGTACCCAAGAACTTTCTCGAGAAAGTTCTTGGGTACAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197945.3-765s21c1
Sequence:CCGGTGTACCCAAGAACTTTCATTCCTCGAGGAATGAAAGTTCTTGGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197945.3-2253s21c1
Sequence:CCGGGCGCATCGAGTCCACTGAAATCTCGAGATTTCAGTGGACTCGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197945.3-4030s21c1
Sequence:CCGGATCCCTCACAATACGTGATTCCTCGAGGAATCACGTATTGTGAGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197945.3-997s21c1
Sequence:CCGGACCAGCCATATCAACCGTATTCTCGAGAATACGGTTGATATGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197945.3-936s21c1
Sequence:CCGGCACAAGCTTGCCCACCTATAGCTCGAGCTATAGGTGGGCAAGCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197945
LZTS3 MISSION shRNA shRNA Plasmid DNA
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197945.2-754s1c1
Sequence:CCGGGTTGTACCCAAGAACTTTCATCTCGAGATGAAAGTTCTTGGGTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197945.2-1903s1c1
Sequence:CCGGGCTTCTCTGGTTTCTGTTGATCTCGAGATCAACAGAAACCAGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197945.2-751s1c2
Sequence:CCGGCCTGTTGTACCCAAGAACTTTCTCGAGAAAGTTCTTGGGTACAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197945.3-765s21c1
Sequence:CCGGTGTACCCAAGAACTTTCATTCCTCGAGGAATGAAAGTTCTTGGGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197945.3-2253s21c1
Sequence:CCGGGCGCATCGAGTCCACTGAAATCTCGAGATTTCAGTGGACTCGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197945.3-4030s21c1
Sequence:CCGGATCCCTCACAATACGTGATTCCTCGAGGAATCACGTATTGTGAGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197945.3-997s21c1
Sequence:CCGGACCAGCCATATCAACCGTATTCTCGAGAATACGGTTGATATGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197945.3-936s21c1
Sequence:CCGGCACAAGCTTGCCCACCTATAGCTCGAGCTATAGGTGGGCAAGCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197945
LZTS3 MISSION shRNA Lentiviral Transduction Particles
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197945.2-754s1c1
Sequence:CCGGGTTGTACCCAAGAACTTTCATCTCGAGATGAAAGTTCTTGGGTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197945.2-1903s1c1
Sequence:CCGGGCTTCTCTGGTTTCTGTTGATCTCGAGATCAACAGAAACCAGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197945.2-751s1c2
Sequence:CCGGCCTGTTGTACCCAAGAACTTTCTCGAGAAAGTTCTTGGGTACAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197945.3-765s21c1
Sequence:CCGGTGTACCCAAGAACTTTCATTCCTCGAGGAATGAAAGTTCTTGGGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197945.3-2253s21c1
Sequence:CCGGGCGCATCGAGTCCACTGAAATCTCGAGATTTCAGTGGACTCGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197945.3-4030s21c1
Sequence:CCGGATCCCTCACAATACGTGATTCCTCGAGGAATCACGTATTGTGAGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197945.3-997s21c1
Sequence:CCGGACCAGCCATATCAACCGTATTCTCGAGAATACGGTTGATATGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197945.3-936s21c1
Sequence:CCGGCACAAGCTTGCCCACCTATAGCTCGAGCTATAGGTGGGCAAGCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)