EMAIL THIS PAGE TO A FRIEND

M1AP

meiosis 1 associated protein

44 Gene Product Result for
Synonyms: C2orf65 D6Mm5e SPATA37
UniProtKB ID: Q8TC57, Q6ZP30, Q96L07
Gene ID:
Mouse(110958) meiosis 1 associated protein
dog(612233) meiosis 1 asscociated protein
cow(541185) meiosis 1 asscociated protein
domestic guinea pig(100735547) meiosis 1 associated protein
naked mole-rat(101724166) meiosis 1 associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138804 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033079 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033079 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033079 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138804 Rosetta Predictions human pricing
NM_033079 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079349 predicted 1016
2 SASI_Hs01_00079350 predicted 733
3 SASI_Hs01_00079353 predicted 1002
4 SASI_Hs02_00363962 predicted 629
5 SASI_Hs02_00363963 predicted 305
6 SASI_Hs01_00079356 predicted 712
7 SASI_Hs01_00079357 predicted 1079
8 SASI_Hs01_00079358 predicted 364
9 SASI_Hs02_00363964 predicted 445
10 SASI_Hs02_00363965 predicted 872
11 SASI_Hs01_00079351 predicted 1752
12 SASI_Hs01_00079352 predicted 873
13 SASI_Hs01_00079354 predicted 320
14 SASI_Hs01_00079355 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118392 predicted 680
2 SASI_Mm02_00337282 predicted 839
3 SASI_Mm02_00337283 predicted 1113
4 SASI_Mm02_00337284 predicted 1755
5 SASI_Mm01_00118394 predicted 705
6 SASI_Mm02_00337285 predicted 840
7 SASI_Mm01_00118396 predicted 565
8 SASI_Mm01_00118397 predicted 1236
9 SASI_Mm02_00337286 predicted 515
10 SASI_Mm01_00118398 predicted 1408
11 SASI_Mm01_00118393 predicted 965
12 SASI_Mm01_00118395 predicted 640
13 SASI_Mm01_00118399 predicted 427
14 SASI_Mm01_00118400 predicted 917
15 SASI_Mm01_00118401 predicted 302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138804
M1AP MISSION shRNA Bacterial Glycerol Stock
meiosis 1 associated protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138804.3-1011s21c1
Sequence:CCGGCCAGTCATCGGCCTCTCATTACTCGAGTAATGAGAGGCCGATGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138804.3-1038s21c1
Sequence:CCGGCCAAGTGATCAAGGCTTTAAACTCGAGTTTAAAGCCTTGATCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138804.3-1750s21c1
Sequence:CCGGTCCATGCTCAGGTTCACATAACTCGAGTTATGTGAACCTGAGCATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138804.2-358s1c1
Sequence:CCGGGTGCAAGTGAAAGGGAACTTTCTCGAGAAAGTTCCCTTTCACTTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138804.2-477s1c1
Sequence:CCGGGCTCCAGCAATTCAAACAATACTCGAGTATTGTTTGAATTGCTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138804.2-2354s1c1
Sequence:CCGGCCACAGAATAATAGCTACCATCTCGAGATGGTAGCTATTATTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138804.2-848s1c1
Sequence:CCGGCACAGTGTTTCAGCAACATTTCTCGAGAAATGTTGCTGAAACACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138804.2-1147s1c1
Sequence:CCGGCTGGAGACAAATCAGCAACATCTCGAGATGTTGCTGATTTGTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138804
M1AP MISSION shRNA shRNA Plasmid DNA
meiosis 1 associated protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138804.3-1011s21c1
Sequence:CCGGCCAGTCATCGGCCTCTCATTACTCGAGTAATGAGAGGCCGATGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138804.3-1038s21c1
Sequence:CCGGCCAAGTGATCAAGGCTTTAAACTCGAGTTTAAAGCCTTGATCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138804.3-1750s21c1
Sequence:CCGGTCCATGCTCAGGTTCACATAACTCGAGTTATGTGAACCTGAGCATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138804.2-358s1c1
Sequence:CCGGGTGCAAGTGAAAGGGAACTTTCTCGAGAAAGTTCCCTTTCACTTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138804.2-477s1c1
Sequence:CCGGGCTCCAGCAATTCAAACAATACTCGAGTATTGTTTGAATTGCTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138804.2-2354s1c1
Sequence:CCGGCCACAGAATAATAGCTACCATCTCGAGATGGTAGCTATTATTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138804.2-848s1c1
Sequence:CCGGCACAGTGTTTCAGCAACATTTCTCGAGAAATGTTGCTGAAACACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138804.2-1147s1c1
Sequence:CCGGCTGGAGACAAATCAGCAACATCTCGAGATGTTGCTGATTTGTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138804
M1AP MISSION shRNA Lentiviral Transduction Particles
meiosis 1 associated protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138804.3-1011s21c1
Sequence:CCGGCCAGTCATCGGCCTCTCATTACTCGAGTAATGAGAGGCCGATGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138804.3-1038s21c1
Sequence:CCGGCCAAGTGATCAAGGCTTTAAACTCGAGTTTAAAGCCTTGATCACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138804.3-1750s21c1
Sequence:CCGGTCCATGCTCAGGTTCACATAACTCGAGTTATGTGAACCTGAGCATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138804.2-358s1c1
Sequence:CCGGGTGCAAGTGAAAGGGAACTTTCTCGAGAAAGTTCCCTTTCACTTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138804.2-477s1c1
Sequence:CCGGGCTCCAGCAATTCAAACAATACTCGAGTATTGTTTGAATTGCTGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161722    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138804.2-2354s1c1
Sequence:CCGGCCACAGAATAATAGCTACCATCTCGAGATGGTAGCTATTATTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138804.2-848s1c1
Sequence:CCGGCACAGTGTTTCAGCAACATTTCTCGAGAAATGTTGCTGAAACACTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138804.2-1147s1c1
Sequence:CCGGCTGGAGACAAATCAGCAACATCTCGAGATGTTGCTGATTTGTCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033079
M1AP MISSION shRNA Bacterial Glycerol Stock
meiosis 1 associated protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033079.2-1864s21c1
Sequence:CCGGGGACTCTCTCTTGGATCATTTCTCGAGAAATGATCCAAGAGAGAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033079.2-986s21c1
Sequence:CCGGGGCTTCAGCCTCTCCGTATAACTCGAGTTATACGGAGAGGCTGAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033079.2-575s21c1
Sequence:CCGGGAAAGATATAAACCTACTTAGCTCGAGCTAAGTAGGTTTATATCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033079.2-848s21c1
Sequence:CCGGGGATCATCCAATATGTCTAAACTCGAGTTTAGACATATTGGATGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033079.2-871s21c1
Sequence:CCGGGTGATCTCCAAGAGCGATTTCCTCGAGGAAATCGCTCTTGGAGATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033079.1-1038s1c1
Sequence:CCGGCCTTCATTCTCAGACCCACAACTCGAGTTGTGGGTCTGAGAATGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033079.1-1082s1c1
Sequence:CCGGGAGCTGGAAACAAATCAACAACTCGAGTTGTTGATTTGTTTCCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033079.1-1206s1c1
Sequence:CCGGGCTTCTATGTGATCACACCTTCTCGAGAAGGTGTGATCACATAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033079
M1AP MISSION shRNA shRNA Plasmid DNA
meiosis 1 associated protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033079.2-1864s21c1
Sequence:CCGGGGACTCTCTCTTGGATCATTTCTCGAGAAATGATCCAAGAGAGAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033079.2-986s21c1
Sequence:CCGGGGCTTCAGCCTCTCCGTATAACTCGAGTTATACGGAGAGGCTGAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033079.2-575s21c1
Sequence:CCGGGAAAGATATAAACCTACTTAGCTCGAGCTAAGTAGGTTTATATCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033079.2-848s21c1
Sequence:CCGGGGATCATCCAATATGTCTAAACTCGAGTTTAGACATATTGGATGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033079.2-871s21c1
Sequence:CCGGGTGATCTCCAAGAGCGATTTCCTCGAGGAAATCGCTCTTGGAGATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033079.1-1038s1c1
Sequence:CCGGCCTTCATTCTCAGACCCACAACTCGAGTTGTGGGTCTGAGAATGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033079.1-1082s1c1
Sequence:CCGGGAGCTGGAAACAAATCAACAACTCGAGTTGTTGATTTGTTTCCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033079.1-1206s1c1
Sequence:CCGGGCTTCTATGTGATCACACCTTCTCGAGAAGGTGTGATCACATAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033079
M1AP MISSION shRNA Lentiviral Transduction Particles
meiosis 1 associated protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033079.2-1864s21c1
Sequence:CCGGGGACTCTCTCTTGGATCATTTCTCGAGAAATGATCCAAGAGAGAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033079.2-986s21c1
Sequence:CCGGGGCTTCAGCCTCTCCGTATAACTCGAGTTATACGGAGAGGCTGAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033079.2-575s21c1
Sequence:CCGGGAAAGATATAAACCTACTTAGCTCGAGCTAAGTAGGTTTATATCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033079.2-848s21c1
Sequence:CCGGGGATCATCCAATATGTCTAAACTCGAGTTTAGACATATTGGATGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033079.2-871s21c1
Sequence:CCGGGTGATCTCCAAGAGCGATTTCCTCGAGGAAATCGCTCTTGGAGATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033079.1-1038s1c1
Sequence:CCGGCCTTCATTCTCAGACCCACAACTCGAGTTGTGGGTCTGAGAATGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033079.1-1082s1c1
Sequence:CCGGGAGCTGGAAACAAATCAACAACTCGAGTTGTTGATTTGTTTCCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033079.1-1206s1c1
Sequence:CCGGGCTTCTATGTGATCACACCTTCTCGAGAAGGTGTGATCACATAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)