EMAIL THIS PAGE TO A FRIEND

M6PR

mannose-6-phosphate receptor (cation dependent)

140 Gene Product Result for
Synonyms: CD-MPR MPR 46 MPR-46 MPR46 SMPR
UniProtKB ID: P20645, A8K528, D3DUV5
Gene ID:
Human(4074) Summary: This gene encodes a member of the P-type lectin family. P-type lectins play a critical role in lysosome function through the specific transport of mannose-6-phosphate-containing acid hydrolases from the Golgi complex to lysosomes. The encoded protein functions as a homodimer and requires divalent cations for ligand binding. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, May 2011]
Mouse(17113) mannose-6-phosphate receptor, cation dependent
Rat(312689) mannose-6-phosphate receptor, cation dependent
naked mole-rat(101704683) mannose-6-phosphate receptor (cation dependent)
domestic guinea pig(100726206) mannose-6-phosphate receptor (cation dependent)
sheep(101102802) mannose-6-phosphate receptor (cation dependent)
Zebrafish(406486) mannose-6-phosphate receptor (cation dependent)
cow(281291) mannose-6-phosphate receptor (cation dependent)
domestic cat(101098389) mannose-6-phosphate receptor (cation dependent)
dog(477700) mannose-6-phosphate receptor (cation dependent)
chicken(396044) mannose-6-phosphate receptor (cation dependent)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002355 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010749 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010749 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010749 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002355 Rosetta Predictions human pricing
NM_001007700 Rosetta Predictions rat pricing
NM_010749 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116975 predicted 1083
2 SASI_Hs01_00116976 predicted 1003
3 SASI_Hs01_00116977 predicted 231
4 SASI_Hs02_00333691 predicted 280
5 SASI_Hs01_00116978 predicted 982
6 SASI_Hs01_00116979 predicted 1008
7 SASI_Hs01_00116980 predicted 975
8 SASI_Hs01_00116982 predicted 478
9 SASI_Hs01_00116983 predicted 970
10 SASI_Hs01_00116984 predicted 294
11 SASI_Hs01_00116981 predicted 1106
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085427 predicted 687
2 SASI_Rn01_00085429 predicted 360
3 SASI_Rn02_00198859 predicted 874
4 SASI_Rn01_00085430 predicted 749
5 SASI_Rn01_00085431 predicted 852
6 SASI_Rn01_00085432 predicted 297
7 SASI_Rn01_00085433 predicted 504
8 SASI_Rn01_00085434 predicted 219
9 SASI_Rn01_00085435 predicted 1074
10 SASI_Rn02_00198860 predicted 488
11 SASI_Rn01_00085428 predicted 654
12 SASI_Rn01_00085436 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103685 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002355
VALIDATED
M6PR MISSION shRNA Bacterial Glycerol Stock
mannose-6-phosphate receptor (cation dependent)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002355.2-309s1c1
Sequence:CCGGGCTCTAGTGAAGAGGCTGAAACTCGAGTTTCAGCCTCTTCACTAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002355.2-819s1c1
Sequence:CCGGGCCAAAGGAATGGAGCAGTTTCTCGAGAAACTGCTCCATTCCTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002355.2-899s1c1
Sequence:CCGGCTGCCGTTCTAAACCTCGAAACTCGAGTTTCGAGGTTTAGAACGGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002355.2-365s1c1
Sequence:CCGGCCAGGGTTCAGACACATACATCTCGAGATGTATGTGTCTGAACCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002355.2-498s1c1
Sequence:CCGGCACATCTTCAACGGAAGTAATCTCGAGATTACTTCCGTTGAAGATGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-309s21c1
Sequence:CCGGGCTCTAGTGAAGAGGCTGAAACTCGAGTTTCAGCCTCTTCACTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-498s21c1
Sequence:CCGGCACATCTTCAACGGAAGTAATCTCGAGATTACTTCCGTTGAAGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-1091s21c1
Sequence:CCGGCCTCATCTCACCCTTACTATTCTCGAGAATAGTAAGGGTGAGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-899s21c1
Sequence:CCGGCTGCCGTTCTAAACCTCGAAACTCGAGTTTCGAGGTTTAGAACGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-819s21c1
Sequence:CCGGGCCAAAGGAATGGAGCAGTTTCTCGAGAAACTGCTCCATTCCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002355
VALIDATED
M6PR MISSION shRNA shRNA Plasmid DNA
mannose-6-phosphate receptor (cation dependent)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002355.2-309s1c1
Sequence:CCGGGCTCTAGTGAAGAGGCTGAAACTCGAGTTTCAGCCTCTTCACTAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002355.2-819s1c1
Sequence:CCGGGCCAAAGGAATGGAGCAGTTTCTCGAGAAACTGCTCCATTCCTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002355.2-899s1c1
Sequence:CCGGCTGCCGTTCTAAACCTCGAAACTCGAGTTTCGAGGTTTAGAACGGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002355.2-365s1c1
Sequence:CCGGCCAGGGTTCAGACACATACATCTCGAGATGTATGTGTCTGAACCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002355.2-498s1c1
Sequence:CCGGCACATCTTCAACGGAAGTAATCTCGAGATTACTTCCGTTGAAGATGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-309s21c1
Sequence:CCGGGCTCTAGTGAAGAGGCTGAAACTCGAGTTTCAGCCTCTTCACTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-498s21c1
Sequence:CCGGCACATCTTCAACGGAAGTAATCTCGAGATTACTTCCGTTGAAGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-1091s21c1
Sequence:CCGGCCTCATCTCACCCTTACTATTCTCGAGAATAGTAAGGGTGAGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-899s21c1
Sequence:CCGGCTGCCGTTCTAAACCTCGAAACTCGAGTTTCGAGGTTTAGAACGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-819s21c1
Sequence:CCGGGCCAAAGGAATGGAGCAGTTTCTCGAGAAACTGCTCCATTCCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002355
VALIDATED
M6PR MISSION shRNA Lentiviral Transduction Particles
mannose-6-phosphate receptor (cation dependent)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002355.2-309s1c1
Sequence:CCGGGCTCTAGTGAAGAGGCTGAAACTCGAGTTTCAGCCTCTTCACTAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002355.2-819s1c1
Sequence:CCGGGCCAAAGGAATGGAGCAGTTTCTCGAGAAACTGCTCCATTCCTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002355.2-899s1c1
Sequence:CCGGCTGCCGTTCTAAACCTCGAAACTCGAGTTTCGAGGTTTAGAACGGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002355.2-365s1c1
Sequence:CCGGCCAGGGTTCAGACACATACATCTCGAGATGTATGTGTCTGAACCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002355.2-498s1c1
Sequence:CCGGCACATCTTCAACGGAAGTAATCTCGAGATTACTTCCGTTGAAGATGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-309s21c1
Sequence:CCGGGCTCTAGTGAAGAGGCTGAAACTCGAGTTTCAGCCTCTTCACTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-498s21c1
Sequence:CCGGCACATCTTCAACGGAAGTAATCTCGAGATTACTTCCGTTGAAGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-1091s21c1
Sequence:CCGGCCTCATCTCACCCTTACTATTCTCGAGAATAGTAAGGGTGAGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-899s21c1
Sequence:CCGGCTGCCGTTCTAAACCTCGAAACTCGAGTTTCGAGGTTTAGAACGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_002355.2-819s21c1
Sequence:CCGGGCCAAAGGAATGGAGCAGTTTCTCGAGAAACTGCTCCATTCCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010749
M6PR MISSION shRNA Bacterial Glycerol Stock
mannose-6-phosphate receptor (cation dependent)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-592s1c1
Sequence:CCGGGCATCATTGGTTGCTGTCTATCTCGAGATAGACAGCAACCAATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-504s1c1
Sequence:CCGGCTTCTACCTCTTTGAGATGGACTCGAGTCCATCTCAAAGAGGTAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-114s1c1
Sequence:CCGGGAAGGATAAGGAGTCAAAGAACTCGAGTTCTTTGACTCCTTATCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-339s1c1
Sequence:CCGGCAATGGAAGTAATTGGATCATCTCGAGATGATCCAATTACTTCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-315s1c1
Sequence:CCGGGAGAATCAACGAGACTCACATCTCGAGATGTGAGTCTCGTTGATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010749.6-473s21c1
Sequence:CCGGGAGAATCAACGAGACTCACATCTCGAGATGTGAGTCTCGTTGATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010749.6-272s21c1
Sequence:CCGGGAAGGATAAGGAGTCAAAGAACTCGAGTTCTTTGACTCCTTATCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010749.6-750s21c1
Sequence:CCGGGCATCATTGGTTGCTGTCTATCTCGAGATAGACAGCAACCAATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010749.6-662s21c1
Sequence:CCGGCTTCTACCTCTTTGAGATGGACTCGAGTCCATCTCAAAGAGGTAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010749
M6PR MISSION shRNA shRNA Plasmid DNA
mannose-6-phosphate receptor (cation dependent)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-592s1c1
Sequence:CCGGGCATCATTGGTTGCTGTCTATCTCGAGATAGACAGCAACCAATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-504s1c1
Sequence:CCGGCTTCTACCTCTTTGAGATGGACTCGAGTCCATCTCAAAGAGGTAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-114s1c1
Sequence:CCGGGAAGGATAAGGAGTCAAAGAACTCGAGTTCTTTGACTCCTTATCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-339s1c1
Sequence:CCGGCAATGGAAGTAATTGGATCATCTCGAGATGATCCAATTACTTCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-315s1c1
Sequence:CCGGGAGAATCAACGAGACTCACATCTCGAGATGTGAGTCTCGTTGATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010749.6-473s21c1
Sequence:CCGGGAGAATCAACGAGACTCACATCTCGAGATGTGAGTCTCGTTGATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010749.6-272s21c1
Sequence:CCGGGAAGGATAAGGAGTCAAAGAACTCGAGTTCTTTGACTCCTTATCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010749.6-750s21c1
Sequence:CCGGGCATCATTGGTTGCTGTCTATCTCGAGATAGACAGCAACCAATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010749.6-662s21c1
Sequence:CCGGCTTCTACCTCTTTGAGATGGACTCGAGTCCATCTCAAAGAGGTAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010749
M6PR MISSION shRNA Lentiviral Transduction Particles
mannose-6-phosphate receptor (cation dependent)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-592s1c1
Sequence:CCGGGCATCATTGGTTGCTGTCTATCTCGAGATAGACAGCAACCAATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-504s1c1
Sequence:CCGGCTTCTACCTCTTTGAGATGGACTCGAGTCCATCTCAAAGAGGTAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-114s1c1
Sequence:CCGGGAAGGATAAGGAGTCAAAGAACTCGAGTTCTTTGACTCCTTATCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-339s1c1
Sequence:CCGGCAATGGAAGTAATTGGATCATCTCGAGATGATCCAATTACTTCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010749.5-315s1c1
Sequence:CCGGGAGAATCAACGAGACTCACATCTCGAGATGTGAGTCTCGTTGATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010749.6-473s21c1
Sequence:CCGGGAGAATCAACGAGACTCACATCTCGAGATGTGAGTCTCGTTGATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010749.6-272s21c1
Sequence:CCGGGAAGGATAAGGAGTCAAAGAACTCGAGTTCTTTGACTCCTTATCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010749.6-750s21c1
Sequence:CCGGGCATCATTGGTTGCTGTCTATCTCGAGATAGACAGCAACCAATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010749.6-662s21c1
Sequence:CCGGCTTCTACCTCTTTGAGATGGACTCGAGTCCATCTCAAAGAGGTAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)