EMAIL THIS PAGE TO A FRIEND

MAATS1

MYCBP-associated, testis expressed 1

72 Gene Product Result for
Synonyms: AAT1 AAT1alpha C3orf15 SPATA26
Gene ID:
Mouse(320214) MYCBP-associated, testis expressed 1
Rat(303920) MYCBP-associated, testis expressed 1
domestic cat(101081073) MYCBP/AMY-1-associated, testis expressed 1
cow(100300968) MYCBP-associated, testis expressed 1
dog(487998) MYCBP/AMY-1-associated, testis expressed 1
sheep(101107403) MYCBP/AMY-1-associated, testis expressed 1
domestic guinea pig(100714114) MYCBP-associated, testis expressed 1
naked mole-rat(101702347) MYCBP-associated, testis expressed 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408160 Anti-C3ORF15 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033364 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093101 MISSION® esiRNA esiRNA human C3orf15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033364 Rosetta Predictions human pricing
XM_001069633 Rosetta Predictions rat pricing
XM_221434 Rosetta Predictions rat pricing
NM_001081025 Rosetta Predictions mouse pricing
XM_001002775 Rosetta Predictions mouse pricing
XM_001002780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197249 predicted 1083
2 SASI_Hs01_00197252 predicted 1169
3 SASI_Hs01_00197253 predicted 1272
4 SASI_Hs01_00197254 predicted 2015
5 SASI_Hs01_00197255 predicted 457
6 SASI_Hs01_00197256 predicted 2030
7 SASI_Hs01_00197257 predicted 1265
8 SASI_Hs02_00361219 predicted 565
9 SASI_Hs02_00361220 predicted 2145
10 SASI_Hs02_00361221 predicted 2362
11 SASI_Hs01_00197248 predicted 1982
12 SASI_Hs01_00197250 predicted 1397
13 SASI_Hs01_00197251 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328732 predicted 1471
2 SASI_Rn02_00328733 predicted 1188
3 SASI_Rn02_00328734 predicted 566
4 SASI_Rn02_00328735 predicted 305
5 SASI_Rn02_00328736 predicted 403
6 SASI_Rn02_00328737 predicted 1668
7 SASI_Rn02_00328738 predicted 1309
8 SASI_Rn02_00328739 predicted 1459
9 SASI_Rn02_00328740 predicted 2045
10 SASI_Rn02_00328741 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221434 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380135 predicted 1472
2 SASI_Rn02_00380136 predicted 1475
3 SASI_Rn02_00380137 predicted 1188
4 SASI_Rn02_00380138 predicted 1478
5 SASI_Rn02_00380139 predicted 574
6 SASI_Rn02_00380140 predicted 306
7 SASI_Rn02_00380141 predicted 409
8 SASI_Rn02_00380142 predicted 1430
9 SASI_Rn02_00380143 predicted 1305
10 SASI_Rn02_00380144 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294468 predicted 1461
2 SASI_Mm02_00294469 predicted 1967
3 SASI_Mm02_00294470 predicted 1144
4 SASI_Mm02_00294471 predicted 285
5 SASI_Mm02_00294472 predicted 999
6 SASI_Mm02_00294473 predicted 1749
7 SASI_Mm02_00294474 predicted 1226
8 SASI_Mm02_00294475 predicted 620
9 SASI_Mm02_00294476 predicted 1078
10 SASI_Mm02_00294477 predicted 2485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250976 predicted 1006
2 SASI_Mm01_00250977 predicted 1027
3 SASI_Mm01_00250978 predicted 1145
4 SASI_Mm01_00250979 predicted 315
5 SASI_Mm01_00250980 predicted 492
6 SASI_Mm01_00250981 predicted 663
7 SASI_Mm01_00250982 predicted 291
8 SASI_Mm01_00250983 predicted 688
9 SASI_Mm01_00250984 predicted 623
10 SASI_Mm01_00250985 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209035 predicted 1466
2 SASI_Mm01_00209036 predicted 1150
3 SASI_Mm01_00209037 predicted 493
4 SASI_Mm01_00209038 predicted 295
5 SASI_Mm01_00209039 predicted 1003
6 SASI_Mm01_00209040 predicted 1233
7 SASI_Mm01_00209041 predicted 618
8 SASI_Mm01_00209042 predicted 1082
9 SASI_Mm01_00209043 predicted 1246
10 SASI_Mm01_00209044 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081025
MAATS1 MISSION shRNA Bacterial Glycerol Stock
MYCBP-associated, testis expressed 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081025.1-1023s21c1
Sequence:CCGGCTGAACGATCAGTGGTATAAACTCGAGTTTATACCACTGATCGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081025.1-195s21c1
Sequence:CCGGTACCTGTACGACCCGTTATTTCTCGAGAAATAACGGGTCGTACAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081025.1-2290s21c1
Sequence:CCGGTGCTGGAGGAGCAAGTCTATACTCGAGTATAGACTTGCTCCTCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081025.1-2527s21c1
Sequence:CCGGAGCGGACTGTCTGTTGTTAAACTCGAGTTTAACAACAGACAGTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081025.1-1162s21c1
Sequence:CCGGTCTCGGACTACTCTAACTTTGCTCGAGCAAAGTTAGAGTAGTCCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081025
MAATS1 MISSION shRNA shRNA Plasmid DNA
MYCBP-associated, testis expressed 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081025.1-1023s21c1
Sequence:CCGGCTGAACGATCAGTGGTATAAACTCGAGTTTATACCACTGATCGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081025.1-195s21c1
Sequence:CCGGTACCTGTACGACCCGTTATTTCTCGAGAAATAACGGGTCGTACAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081025.1-2290s21c1
Sequence:CCGGTGCTGGAGGAGCAAGTCTATACTCGAGTATAGACTTGCTCCTCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081025.1-2527s21c1
Sequence:CCGGAGCGGACTGTCTGTTGTTAAACTCGAGTTTAACAACAGACAGTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081025.1-1162s21c1
Sequence:CCGGTCTCGGACTACTCTAACTTTGCTCGAGCAAAGTTAGAGTAGTCCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081025
MAATS1 MISSION shRNA Lentiviral Transduction Particles
MYCBP-associated, testis expressed 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081025.1-1023s21c1
Sequence:CCGGCTGAACGATCAGTGGTATAAACTCGAGTTTATACCACTGATCGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081025.1-195s21c1
Sequence:CCGGTACCTGTACGACCCGTTATTTCTCGAGAAATAACGGGTCGTACAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081025.1-2290s21c1
Sequence:CCGGTGCTGGAGGAGCAAGTCTATACTCGAGTATAGACTTGCTCCTCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081025.1-2527s21c1
Sequence:CCGGAGCGGACTGTCTGTTGTTAAACTCGAGTTTAACAACAGACAGTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081025.1-1162s21c1
Sequence:CCGGTCTCGGACTACTCTAACTTTGCTCGAGCAAAGTTAGAGTAGTCCGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033364
MAATS1 MISSION shRNA Bacterial Glycerol Stock
MYCBP-associated, testis expressed 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033364.2-570s1c1
Sequence:CCGGCCAAGGCAGAACCATACACTTCTCGAGAAGTGTATGGTTCTGCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033364.2-3995s1c1
Sequence:CCGGCCATCATAACTGCATACTCAACTCGAGTTGAGTATGCAGTTATGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033364.2-3761s1c1
Sequence:CCGGCCAGTAAGGAAGCAACTAAATCTCGAGATTTAGTTGCTTCCTTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033364.2-3075s1c1
Sequence:CCGGCCTGATTCAAAGACTGTCAAACTCGAGTTTGACAGTCTTTGAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033364.2-571s1c1
Sequence:CCGGCAAGGCAGAACCATACACTTTCTCGAGAAAGTGTATGGTTCTGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033364.2-310s1c1
Sequence:CCGGCCTGATCCATTATCCAAGATACTCGAGTATCTTGGATAATGGATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033364.2-482s1c1
Sequence:CCGGGTTACTGGAAAGAATCGCTATCTCGAGATAGCGATTCTTTCCAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033364.2-2225s1c1
Sequence:CCGGGCACAGCGGAAACATATTCTTCTCGAGAAGAATATGTTTCCGCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033364
MAATS1 MISSION shRNA shRNA Plasmid DNA
MYCBP-associated, testis expressed 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033364.2-570s1c1
Sequence:CCGGCCAAGGCAGAACCATACACTTCTCGAGAAGTGTATGGTTCTGCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033364.2-3995s1c1
Sequence:CCGGCCATCATAACTGCATACTCAACTCGAGTTGAGTATGCAGTTATGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033364.2-3761s1c1
Sequence:CCGGCCAGTAAGGAAGCAACTAAATCTCGAGATTTAGTTGCTTCCTTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033364.2-3075s1c1
Sequence:CCGGCCTGATTCAAAGACTGTCAAACTCGAGTTTGACAGTCTTTGAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033364.2-571s1c1
Sequence:CCGGCAAGGCAGAACCATACACTTTCTCGAGAAAGTGTATGGTTCTGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033364.2-310s1c1
Sequence:CCGGCCTGATCCATTATCCAAGATACTCGAGTATCTTGGATAATGGATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033364.2-482s1c1
Sequence:CCGGGTTACTGGAAAGAATCGCTATCTCGAGATAGCGATTCTTTCCAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033364.2-2225s1c1
Sequence:CCGGGCACAGCGGAAACATATTCTTCTCGAGAAGAATATGTTTCCGCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033364
MAATS1 MISSION shRNA Lentiviral Transduction Particles
MYCBP-associated, testis expressed 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033364.2-570s1c1
Sequence:CCGGCCAAGGCAGAACCATACACTTCTCGAGAAGTGTATGGTTCTGCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033364.2-3995s1c1
Sequence:CCGGCCATCATAACTGCATACTCAACTCGAGTTGAGTATGCAGTTATGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134053    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033364.2-3761s1c1
Sequence:CCGGCCAGTAAGGAAGCAACTAAATCTCGAGATTTAGTTGCTTCCTTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134107    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033364.2-3075s1c1
Sequence:CCGGCCTGATTCAAAGACTGTCAAACTCGAGTTTGACAGTCTTTGAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033364.2-571s1c1
Sequence:CCGGCAAGGCAGAACCATACACTTTCTCGAGAAAGTGTATGGTTCTGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033364.2-310s1c1
Sequence:CCGGCCTGATCCATTATCCAAGATACTCGAGTATCTTGGATAATGGATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033364.2-482s1c1
Sequence:CCGGGTTACTGGAAAGAATCGCTATCTCGAGATAGCGATTCTTTCCAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033364.2-2225s1c1
Sequence:CCGGGCACAGCGGAAACATATTCTTCTCGAGAAGAATATGTTTCCGCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)