EMAIL THIS PAGE TO A FRIEND

MAB21L1

mab-21-like 1 (C. elegans)

102 Gene Product Result for
Synonyms: CAGR1
UniProtKB ID: Q13394, Q6I9T5
Gene ID:
Human(4081) Summary: This gene is similar to the MAB-21 cell fate-determining gene found in C. elegans. It may be involved in eye and cerebellum development, and it has been proposed that expansion of a trinucleotide repeat region in the 5' UTR may play a role in a variety of psychiatric disorders. [provided by RefSeq, Oct 2008]
Mouse(17116) mab-21-like 1 (C. elegans)
Rat(688394) mab-21-like 1 (C. elegans)
Zebrafish(246091) mab-21-like 1
cow(540081) mab-21-like 1 (C. elegans)
Horse(100062356) mab-21-like 1 (C. elegans)
domestic cat(101083134) mab-21-like 1 (C. elegans)
dog(486012) mab-21-like 1 (C. elegans)
chicken(395208) mab-21-like 1 (C. elegans)
naked mole-rat(101720817) mab-21-like 1 (C. elegans)
Domestic Rabbit(100339680) mab-21-like 1 (C. elegans)
domestic guinea pig(100725065) mab-21-like 1 (C. elegans)
sheep(101107875) mab-21-like 1 (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005584 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005584 Rosetta Predictions human pricing
NM_001109497 Rosetta Predictions rat pricing
NM_010750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032219 predicted 1604
2 SASI_Hs01_00032220 predicted 1662
3 SASI_Hs01_00032221 predicted 1615
4 SASI_Hs01_00032222 predicted 728
5 SASI_Hs01_00032223 predicted 991
6 SASI_Hs01_00032224 predicted 1033
7 SASI_Hs01_00032225 predicted 1034
8 SASI_Hs01_00032226 predicted 1280
9 SASI_Hs01_00032227 predicted 726
10 SASI_Hs01_00032228 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248979 predicted 1842
2 SASI_Rn02_00248980 predicted 1201
3 SASI_Rn02_00248981 predicted 1365
4 SASI_Rn02_00248982 predicted 975
5 SASI_Rn02_00248983 predicted 1079
6 SASI_Rn02_00248984 predicted 1925
7 SASI_Rn02_00248985 predicted 1855
8 SASI_Rn02_00248986 predicted 1970
9 SASI_Rn02_00248987 predicted 1120
10 SASI_Rn02_00248988 predicted 1827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071149 predicted 1001
2 SASI_Mm01_00071150 predicted 1586
3 SASI_Mm01_00071151 predicted 958
4 SASI_Mm01_00071152 predicted 1094
5 SASI_Mm01_00071153 predicted 1282
6 SASI_Mm01_00071154 predicted 992
7 SASI_Mm01_00071155 predicted 1579
8 SASI_Mm02_00319263 predicted 969
9 SASI_Mm01_00071156 predicted 1496
10 SASI_Mm01_00071157 predicted 956
11 SASI_Mm01_00071148 predicted 1206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005584
VALIDATED
MAB21L1 MISSION shRNA Bacterial Glycerol Stock
mab-21-like 1 (C. elegans)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005584.3-1031s21c1
Sequence:CCGGGAAACTGAGAATCCGAGATAGCTCGAGCTATCTCGGATTCTCAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005584.3-1670s21c1
Sequence:CCGGCCTTCTCAAAGTCCTTATTAACTCGAGTTAATAAGGACTTTGAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-735s1c1
Sequence:CCGGCGAATTTGAAGTGGTGCTTTACTCGAGTAAAGCACCACTTCAAATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005584.2-983s1c1
Sequence:CCGGCCAGCGAAGTGAAACTGAGAACTCGAGTTCTCAGTTTCACTTCGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005584.3-713s21c1
Sequence:CCGGCATCAGCTCTCTCAACGAGATCTCGAGATCTCGTTGAGAGAGCTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-613s1c1
Sequence:CCGGCGGGAAGTCTGCAAAGTAGTTCTCGAGAACTACTTTGCAGACTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-687s1c1
Sequence:CCGGCAACGAGATGGACAATCGCTACTCGAGTAGCGATTGTCCATCTCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-929s1c1
Sequence:CCGGCTCAAGCGGTAGACAAATGTACTCGAGTACATTTGTCTACCGCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-1480s1c1
Sequence:CCGGCTACCGAACTTAGATCTGTTTCTCGAGAAACAGATCTAAGTTCGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-1483s1c1
Sequence:CCGGCCGAACTTAGATCTGTTTCAACTCGAGTTGAAACAGATCTAAGTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005584.2-1992s1c1
Sequence:CCGGGCCATCTGAAAGAAACTGTAACTCGAGTTACAGTTTCTTTCAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005584.3-1646s21c1
Sequence:CCGGTTAATCAAGAGCCGAAATTATCTCGAGATAATTTCGGCTCTTGATTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005584.3-1510s21c1
Sequence:CCGGACTACTTTCTACCGAACTTAGCTCGAGCTAAGTTCGGTAGAAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005584.3-1358s21c1
Sequence:CCGGGCCCTTGAACAATTACCATATCTCGAGATATGGTAATTGTTCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005584
VALIDATED
MAB21L1 MISSION shRNA shRNA Plasmid DNA
mab-21-like 1 (C. elegans)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005584.3-1031s21c1
Sequence:CCGGGAAACTGAGAATCCGAGATAGCTCGAGCTATCTCGGATTCTCAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005584.3-1670s21c1
Sequence:CCGGCCTTCTCAAAGTCCTTATTAACTCGAGTTAATAAGGACTTTGAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-735s1c1
Sequence:CCGGCGAATTTGAAGTGGTGCTTTACTCGAGTAAAGCACCACTTCAAATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005584.2-983s1c1
Sequence:CCGGCCAGCGAAGTGAAACTGAGAACTCGAGTTCTCAGTTTCACTTCGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005584.3-713s21c1
Sequence:CCGGCATCAGCTCTCTCAACGAGATCTCGAGATCTCGTTGAGAGAGCTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-613s1c1
Sequence:CCGGCGGGAAGTCTGCAAAGTAGTTCTCGAGAACTACTTTGCAGACTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-687s1c1
Sequence:CCGGCAACGAGATGGACAATCGCTACTCGAGTAGCGATTGTCCATCTCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-929s1c1
Sequence:CCGGCTCAAGCGGTAGACAAATGTACTCGAGTACATTTGTCTACCGCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-1480s1c1
Sequence:CCGGCTACCGAACTTAGATCTGTTTCTCGAGAAACAGATCTAAGTTCGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-1483s1c1
Sequence:CCGGCCGAACTTAGATCTGTTTCAACTCGAGTTGAAACAGATCTAAGTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005584.2-1992s1c1
Sequence:CCGGGCCATCTGAAAGAAACTGTAACTCGAGTTACAGTTTCTTTCAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005584.3-1646s21c1
Sequence:CCGGTTAATCAAGAGCCGAAATTATCTCGAGATAATTTCGGCTCTTGATTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005584.3-1510s21c1
Sequence:CCGGACTACTTTCTACCGAACTTAGCTCGAGCTAAGTTCGGTAGAAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005584.3-1358s21c1
Sequence:CCGGGCCCTTGAACAATTACCATATCTCGAGATATGGTAATTGTTCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005584
VALIDATED
MAB21L1 MISSION shRNA Lentiviral Transduction Particles
mab-21-like 1 (C. elegans)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005584.3-1031s21c1
Sequence:CCGGGAAACTGAGAATCCGAGATAGCTCGAGCTATCTCGGATTCTCAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005584.3-1670s21c1
Sequence:CCGGCCTTCTCAAAGTCCTTATTAACTCGAGTTAATAAGGACTTTGAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-735s1c1
Sequence:CCGGCGAATTTGAAGTGGTGCTTTACTCGAGTAAAGCACCACTTCAAATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005584.2-983s1c1
Sequence:CCGGCCAGCGAAGTGAAACTGAGAACTCGAGTTCTCAGTTTCACTTCGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005584.3-713s21c1
Sequence:CCGGCATCAGCTCTCTCAACGAGATCTCGAGATCTCGTTGAGAGAGCTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-613s1c1
Sequence:CCGGCGGGAAGTCTGCAAAGTAGTTCTCGAGAACTACTTTGCAGACTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-687s1c1
Sequence:CCGGCAACGAGATGGACAATCGCTACTCGAGTAGCGATTGTCCATCTCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-929s1c1
Sequence:CCGGCTCAAGCGGTAGACAAATGTACTCGAGTACATTTGTCTACCGCTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-1480s1c1
Sequence:CCGGCTACCGAACTTAGATCTGTTTCTCGAGAAACAGATCTAAGTTCGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005584.2-1483s1c1
Sequence:CCGGCCGAACTTAGATCTGTTTCAACTCGAGTTGAAACAGATCTAAGTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005584.2-1992s1c1
Sequence:CCGGGCCATCTGAAAGAAACTGTAACTCGAGTTACAGTTTCTTTCAGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005584.3-1646s21c1
Sequence:CCGGTTAATCAAGAGCCGAAATTATCTCGAGATAATTTCGGCTCTTGATTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005584.3-1510s21c1
Sequence:CCGGACTACTTTCTACCGAACTTAGCTCGAGCTAAGTTCGGTAGAAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005584.3-1358s21c1
Sequence:CCGGGCCCTTGAACAATTACCATATCTCGAGATATGGTAATTGTTCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010750
VALIDATED
MAB21L1 MISSION shRNA Bacterial Glycerol Stock
mab-21-like 1 (C. elegans)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010750.3-1002s21c1
Sequence:CCGGCCTTTAAATGCACCGGGATTTCTCGAGAAATCCCGGTGCATTTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010750.2-1655s1c1
Sequence:CCGGGCAAACAATCTCTTCCTTTAACTCGAGTTAAAGGAAGAGATTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010750.3-1436s1c1
Sequence:CCGGCATTACTTCTTACCGAACTTACTCGAGTAAGTTCGGTAAGAAGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010750.3-1437s21c1
Sequence:CCGGATTACTTCTTACCGAACTTAGCTCGAGCTAAGTTCGGTAAGAAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010750.2-507s1c1
Sequence:CCGGGAATAAGTACTACAACGAGAACTCGAGTTCTCGTTGTAGTACTTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010750.2-1209s1c1
Sequence:CCGGCAGGAAGAAATGCCTCTCTATCTCGAGATAGAGAGGCATTTCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010750.3-2453s21c1
Sequence:CCGGTTTCGACAAACAGGTTAATAACTCGAGTTATTAACCTGTTTGTCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010750.3-1347s21c1
Sequence:CCGGAGTCGGACTGGGACGAATCTTCTCGAGAAGATTCGTCCCAGTCCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010750.3-958s1c1
Sequence:CCGGGAAACTGAGAATCCGAGATAGCTCGAGCTATCTCGGATTCTCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010750.3-958s21c1
Sequence:CCGGGAAACTGAGAATCCGAGATAGCTCGAGCTATCTCGGATTCTCAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010750
VALIDATED
MAB21L1 MISSION shRNA shRNA Plasmid DNA
mab-21-like 1 (C. elegans)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010750.3-1002s21c1
Sequence:CCGGCCTTTAAATGCACCGGGATTTCTCGAGAAATCCCGGTGCATTTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010750.2-1655s1c1
Sequence:CCGGGCAAACAATCTCTTCCTTTAACTCGAGTTAAAGGAAGAGATTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010750.3-1436s1c1
Sequence:CCGGCATTACTTCTTACCGAACTTACTCGAGTAAGTTCGGTAAGAAGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010750.3-1437s21c1
Sequence:CCGGATTACTTCTTACCGAACTTAGCTCGAGCTAAGTTCGGTAAGAAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010750.2-507s1c1
Sequence:CCGGGAATAAGTACTACAACGAGAACTCGAGTTCTCGTTGTAGTACTTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010750.2-1209s1c1
Sequence:CCGGCAGGAAGAAATGCCTCTCTATCTCGAGATAGAGAGGCATTTCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010750.3-2453s21c1
Sequence:CCGGTTTCGACAAACAGGTTAATAACTCGAGTTATTAACCTGTTTGTCGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010750.3-1347s21c1
Sequence:CCGGAGTCGGACTGGGACGAATCTTCTCGAGAAGATTCGTCCCAGTCCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010750.3-958s1c1
Sequence:CCGGGAAACTGAGAATCCGAGATAGCTCGAGCTATCTCGGATTCTCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010750.3-958s21c1
Sequence:CCGGGAAACTGAGAATCCGAGATAGCTCGAGCTATCTCGGATTCTCAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010750
VALIDATED
MAB21L1 MISSION shRNA Lentiviral Transduction Particles
mab-21-like 1 (C. elegans)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010750.3-1002s21c1
Sequence:CCGGCCTTTAAATGCACCGGGATTTCTCGAGAAATCCCGGTGCATTTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010750.2-1655s1c1
Sequence:CCGGGCAAACAATCTCTTCCTTTAACTCGAGTTAAAGGAAGAGATTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010750.3-1436s1c1
Sequence:CCGGCATTACTTCTTACCGAACTTACTCGAGTAAGTTCGGTAAGAAGTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010750.3-1437s21c1
Sequence:CCGGATTACTTCTTACCGAACTTAGCTCGAGCTAAGTTCGGTAAGAAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010750.2-507s1c1
Sequence:CCGGGAATAAGTACTACAACGAGAACTCGAGTTCTCGTTGTAGTACTTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010750.2-1209s1c1
Sequence:CCGGCAGGAAGAAATGCCTCTCTATCTCGAGATAGAGAGGCATTTCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010750.3-2453s21c1
Sequence:CCGGTTTCGACAAACAGGTTAATAACTCGAGTTATTAACCTGTTTGTCGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010750.3-1347s21c1
Sequence:CCGGAGTCGGACTGGGACGAATCTTCTCGAGAAGATTCGTCCCAGTCCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010750.3-958s1c1
Sequence:CCGGGAAACTGAGAATCCGAGATAGCTCGAGCTATCTCGGATTCTCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010750.3-958s21c1
Sequence:CCGGGAAACTGAGAATCCGAGATAGCTCGAGCTATCTCGGATTCTCAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)