EMAIL THIS PAGE TO A FRIEND

MAB21L3

mab-21-like 3 (C. elegans)

77 Gene Product Result for
Synonyms: C1orf161 RP5-1185H19.1
UniProtKB ID: Q8N8X9, Q5TDL7
Gene ID:
Mouse(242125) mab-21-like 3 (C. elegans)
Rat(295326) mab-21-like 3 (C. elegans)
Zebrafish(558164) mab-21-like 3
chicken(770247) mab-21-like 3 (C. elegans)
cow(518597) mab-21-like 3 (C. elegans)
domestic cat(101084642) mab-21-like 3 (C. elegans)
dog(483137) mab-21-like 3 (C. elegans)
naked mole-rat(101725059) mab-21-like 3 (C. elegans)
domestic guinea pig(100734486) mab-21-like 3 (C. elegans)
sheep(101110381) mab-21-like 3 (C. elegans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152367 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152367 Rosetta Predictions human pricing
NM_001106456 Rosetta Predictions rat pricing
NM_172295 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199290 predicted 799
2 SASI_Hs01_00199291 predicted 1220
3 SASI_Hs01_00199292 predicted 468
4 SASI_Hs01_00199293 predicted 524
5 SASI_Hs01_00199294 predicted 931
6 SASI_Hs01_00199295 predicted 1331
7 SASI_Hs01_00199296 predicted 665
8 SASI_Hs01_00199297 predicted 1433
9 SASI_Hs01_00199298 predicted 1076
10 SASI_Hs01_00199299 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106456 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219138 predicted 919
2 SASI_Rn02_00219139 predicted 604
3 SASI_Rn02_00219140 predicted 329
4 SASI_Rn02_00219141 predicted 1086
5 SASI_Rn02_00219142 predicted 239
6 SASI_Rn02_00219143 predicted 458
7 SASI_Rn02_00219144 predicted 464
8 SASI_Rn02_00219145 predicted 424
9 SASI_Rn02_00219146 predicted 851
10 SASI_Rn02_00219147 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185682 predicted 1622
2 SASI_Mm01_00185683 predicted 424
3 SASI_Mm01_00185684 predicted 738
4 SASI_Mm01_00185685 predicted 1580
5 SASI_Mm01_00185687 predicted 914
6 SASI_Mm01_00185688 predicted 740
7 SASI_Mm02_00343782 predicted 1037
8 SASI_Mm01_00185690 predicted 364
9 SASI_Mm02_00343783 predicted 1528
10 SASI_Mm01_00185691 predicted 1517
11 SASI_Mm01_00185686 predicted 205
12 SASI_Mm01_00185689 predicted 1785
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152367
MAB21L3 MISSION shRNA Bacterial Glycerol Stock
mab-21-like 3 (C. elegans)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-919s1c1
Sequence:CCGGCATCAAGTCGTTTGGGTTTAACTCGAGTTAAACCCAAACGACTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-422s1c1
Sequence:CCGGCCTTACTCTGACACGTACAATCTCGAGATTGTACGTGTCAGAGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152367.1-2396s1c1
Sequence:CCGGGCACAGTTATTACAGATGGAACTCGAGTTCCATCTGTAATAACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152367.2-1467s21c1
Sequence:CCGGGCAGCGGAAATTACATCAAACCTCGAGGTTTGATGTAATTTCCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152367.1-2570s1c1
Sequence:CCGGGCCAGGAAGGAATCAGTATTTCTCGAGAAATACTGATTCCTTCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152367.2-919s21c1
Sequence:CCGGCATCAAGTCGTTTGGATTTAACTCGAGTTAAATCCAAACGACTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152367.1-3065s1c1
Sequence:CCGGGCAAGAGCAAACACATTCAAACTCGAGTTTGAATGTGTTTGCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-1225s1c1
Sequence:CCGGCCAGCACTTCCTGAAACACTACTCGAGTAGTGTTTCAGGAAGTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-656s1c1
Sequence:CCGGGTGAACATCGACGGAGACATTCTCGAGAATGTCTCCGTCGATGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-421s1c1
Sequence:CCGGGCCTTACTCTGACACGTACAACTCGAGTTGTACGTGTCAGAGTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152367
MAB21L3 MISSION shRNA shRNA Plasmid DNA
mab-21-like 3 (C. elegans)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-919s1c1
Sequence:CCGGCATCAAGTCGTTTGGGTTTAACTCGAGTTAAACCCAAACGACTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-422s1c1
Sequence:CCGGCCTTACTCTGACACGTACAATCTCGAGATTGTACGTGTCAGAGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152367.1-2396s1c1
Sequence:CCGGGCACAGTTATTACAGATGGAACTCGAGTTCCATCTGTAATAACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152367.2-1467s21c1
Sequence:CCGGGCAGCGGAAATTACATCAAACCTCGAGGTTTGATGTAATTTCCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152367.1-2570s1c1
Sequence:CCGGGCCAGGAAGGAATCAGTATTTCTCGAGAAATACTGATTCCTTCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152367.2-919s21c1
Sequence:CCGGCATCAAGTCGTTTGGATTTAACTCGAGTTAAATCCAAACGACTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152367.1-3065s1c1
Sequence:CCGGGCAAGAGCAAACACATTCAAACTCGAGTTTGAATGTGTTTGCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-1225s1c1
Sequence:CCGGCCAGCACTTCCTGAAACACTACTCGAGTAGTGTTTCAGGAAGTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-656s1c1
Sequence:CCGGGTGAACATCGACGGAGACATTCTCGAGAATGTCTCCGTCGATGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-421s1c1
Sequence:CCGGGCCTTACTCTGACACGTACAACTCGAGTTGTACGTGTCAGAGTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152367
MAB21L3 MISSION shRNA Lentiviral Transduction Particles
mab-21-like 3 (C. elegans)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-919s1c1
Sequence:CCGGCATCAAGTCGTTTGGGTTTAACTCGAGTTAAACCCAAACGACTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-422s1c1
Sequence:CCGGCCTTACTCTGACACGTACAATCTCGAGATTGTACGTGTCAGAGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152367.1-2396s1c1
Sequence:CCGGGCACAGTTATTACAGATGGAACTCGAGTTCCATCTGTAATAACTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152367.2-1467s21c1
Sequence:CCGGGCAGCGGAAATTACATCAAACCTCGAGGTTTGATGTAATTTCCGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152367.1-2570s1c1
Sequence:CCGGGCCAGGAAGGAATCAGTATTTCTCGAGAAATACTGATTCCTTCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152367.2-919s21c1
Sequence:CCGGCATCAAGTCGTTTGGATTTAACTCGAGTTAAATCCAAACGACTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152367.1-3065s1c1
Sequence:CCGGGCAAGAGCAAACACATTCAAACTCGAGTTTGAATGTGTTTGCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-1225s1c1
Sequence:CCGGCCAGCACTTCCTGAAACACTACTCGAGTAGTGTTTCAGGAAGTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-656s1c1
Sequence:CCGGGTGAACATCGACGGAGACATTCTCGAGAATGTCTCCGTCGATGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152367.1-421s1c1
Sequence:CCGGGCCTTACTCTGACACGTACAACTCGAGTTGTACGTGTCAGAGTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172295
MAB21L3 MISSION shRNA Bacterial Glycerol Stock
mab-21-like 3 (C. elegans)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.3-918s1c1
Sequence:CCGGCATCAAGTCCTTTGGGTTTAACTCGAGTTAAACCCAAAGGACTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172295.2-2847s1c1
Sequence:CCGGCCACTGAAGAAAGTGCCATTACTCGAGTAATGGCACTTTCTTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.2-215s1c1
Sequence:CCGGCGGGAAAGAAAGCAGAAGGTTCTCGAGAACCTTCTGCTTTCTTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.2-370s1c1
Sequence:CCGGCCACCTGCTAACCACAGAAATCTCGAGATTTCTGTGGTTAGCAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.2-138s1c1
Sequence:CCGGCACGTTCACAATTCCAGAGAACTCGAGTTCTCTGGAATTGTGAACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.2-211s1c1
Sequence:CCGGCCATCGGGAAAGAAAGCAGAACTCGAGTTCTGCTTTCTTTCCCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172295.2-1450s1c1
Sequence:CCGGCCTGCCAATGACAGAGAGAATCTCGAGATTCTCTCTGTCATTGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172295.2-1873s1c1
Sequence:CCGGGCCTATAACTTGCTTCCATTTCTCGAGAAATGGAAGCAAGTTATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172295
MAB21L3 MISSION shRNA shRNA Plasmid DNA
mab-21-like 3 (C. elegans)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.3-918s1c1
Sequence:CCGGCATCAAGTCCTTTGGGTTTAACTCGAGTTAAACCCAAAGGACTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172295.2-2847s1c1
Sequence:CCGGCCACTGAAGAAAGTGCCATTACTCGAGTAATGGCACTTTCTTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.2-215s1c1
Sequence:CCGGCGGGAAAGAAAGCAGAAGGTTCTCGAGAACCTTCTGCTTTCTTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.2-370s1c1
Sequence:CCGGCCACCTGCTAACCACAGAAATCTCGAGATTTCTGTGGTTAGCAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.2-138s1c1
Sequence:CCGGCACGTTCACAATTCCAGAGAACTCGAGTTCTCTGGAATTGTGAACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.2-211s1c1
Sequence:CCGGCCATCGGGAAAGAAAGCAGAACTCGAGTTCTGCTTTCTTTCCCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172295.2-1450s1c1
Sequence:CCGGCCTGCCAATGACAGAGAGAATCTCGAGATTCTCTCTGTCATTGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172295.2-1873s1c1
Sequence:CCGGGCCTATAACTTGCTTCCATTTCTCGAGAAATGGAAGCAAGTTATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172295
MAB21L3 MISSION shRNA Lentiviral Transduction Particles
mab-21-like 3 (C. elegans)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.3-918s1c1
Sequence:CCGGCATCAAGTCCTTTGGGTTTAACTCGAGTTAAACCCAAAGGACTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172295.2-2847s1c1
Sequence:CCGGCCACTGAAGAAAGTGCCATTACTCGAGTAATGGCACTTTCTTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.2-215s1c1
Sequence:CCGGCGGGAAAGAAAGCAGAAGGTTCTCGAGAACCTTCTGCTTTCTTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.2-370s1c1
Sequence:CCGGCCACCTGCTAACCACAGAAATCTCGAGATTTCTGTGGTTAGCAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.2-138s1c1
Sequence:CCGGCACGTTCACAATTCCAGAGAACTCGAGTTCTCTGGAATTGTGAACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172295.2-211s1c1
Sequence:CCGGCCATCGGGAAAGAAAGCAGAACTCGAGTTCTGCTTTCTTTCCCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172295.2-1450s1c1
Sequence:CCGGCCTGCCAATGACAGAGAGAATCTCGAGATTCTCTCTGTCATTGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172295.2-1873s1c1
Sequence:CCGGGCCTATAACTTGCTTCCATTTCTCGAGAAATGGAAGCAAGTTATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)