EMAIL THIS PAGE TO A FRIEND

MACC1

metastasis associated in colon cancer 1

76 Gene Product Result for
Synonyms: 7A5 SH3BP4L
UniProtKB ID: Q6ZN28, A8MUS5, B2RNR9, Q6ZQN8, Q7Z5A5
Gene ID:
Human(346389) Summary: MACC1 is a key regulator of the hepatocyte growth factor (HGF; MIM 142409)-HGF receptor (HGFR, or MET; MIM 164860) pathway, which is involved in cellular growth, epithelial-mesenchymal transition, angiogenesis, cell motility, invasiveness, and metastasis. Expression of MACC1 in colon cancer (MIM 114500) specimens is an independent prognostic indicator for metastasis formation and metastasis-free survival (Stein et al., 2009 [PubMed 19098908]
Mouse(238455) metastasis associated in colon cancer 1
Rat(314539) metastasis associated in colon cancer 1
Zebrafish(558777) metastasis associated in colon cancer 1
cow(521867) metastasis associated in colon cancer 1
domestic cat(101087465) metastasis associated in colon cancer 1
dog(482343) metastasis associated in colon cancer 1
chicken(420604) metastasis associated in colon cancer 1
sheep(101107275) metastasis associated in colon cancer 1
domestic guinea pig(100731012) metastasis associated in colon cancer 1
naked mole-rat(101703897) metastasis associated in colon cancer 1
Domestic Rabbit(100358685) metastasis associated in colon cancer 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163136 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163136 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163136 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182762 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182762 Rosetta Predictions human pricing
XM_001062324 Rosetta Predictions rat pricing
XM_234727 Rosetta Predictions rat pricing
XM_138397 Rosetta Predictions mouse pricing
XM_906766 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087460 predicted 586
2 SASI_Hs01_00087462 predicted 990
3 SASI_Hs02_00370924 predicted 2203
4 SASI_Hs01_00087464 predicted 1535
5 SASI_Hs01_00087465 predicted 1228
6 SASI_Hs02_00370925 predicted 2657
7 SASI_Hs01_00087466 predicted 2592
8 SASI_Hs01_00087467 predicted 2117
9 SASI_Hs01_00087468 predicted 1339
10 SASI_Hs02_00370926 predicted 1843
11 SASI_Hs01_00087459 predicted 2167
12 SASI_Hs01_00087461 predicted 1395
13 SASI_Hs01_00087463 predicted 2001
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303095 predicted 1929
2 SASI_Rn02_00303096 predicted 1667
3 SASI_Rn02_00303097 predicted 1174
4 SASI_Rn02_00303098 predicted 566
5 SASI_Rn02_00303099 predicted 1229
6 SASI_Rn02_00303100 predicted 1069
7 SASI_Rn02_00303101 predicted 769
8 SASI_Rn02_00303102 predicted 785
9 SASI_Rn02_00303103 predicted 1205
10 SASI_Rn02_00303104 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388667 predicted 2113
2 SASI_Rn02_00388668 predicted 1844
3 SASI_Rn02_00388669 predicted 1361
4 SASI_Rn02_00388670 predicted 753
5 SASI_Rn02_00388671 predicted 1412
6 SASI_Rn02_00388672 predicted 1259
7 SASI_Rn02_00388673 predicted 953
8 SASI_Rn02_00388674 predicted 961
9 SASI_Rn02_00388675 predicted 1389
10 SASI_Rn02_00388676 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278972 predicted 1721
2 SASI_Mm01_00278973 predicted 575
3 SASI_Mm02_00424818 predicted 734
4 SASI_Mm01_00278974 predicted 988
5 SASI_Mm01_00278975 predicted 784
6 SASI_Mm01_00278976 predicted 1108
7 SASI_Mm01_00278977 predicted 763
8 SASI_Mm01_00278978 predicted 1230
9 SASI_Mm01_00278979 predicted 1181
10 SASI_Mm01_00278980 predicted 1162
11 SASI_Mm01_00278981 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432750 predicted 1718
2 SASI_Mm02_00432751 predicted 571
3 SASI_Mm02_00432752 predicted 735
4 SASI_Mm02_00432753 predicted 989
5 SASI_Mm02_00432754 predicted 784
6 SASI_Mm02_00432755 predicted 1109
7 SASI_Mm02_00432756 predicted 772
8 SASI_Mm02_00432757 predicted 1229
9 SASI_Mm02_00432758 predicted 1177
10 SASI_Mm02_00432759 predicted 1160
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163136
MACC1 MISSION shRNA Bacterial Glycerol Stock
metastasis associated in colon cancer 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163136.1-1232s21c1
Sequence:CCGGACACATCTCCAGTCGTATTTCCTCGAGGAAATACGACTGGAGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163136.1-683s21c1
Sequence:CCGGCCGACTCAGACATCACTATTCCTCGAGGAATAGTGATGTCTGAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163136.1-2714s21c1
Sequence:CCGGTACCCATGAGGCTAGTGTAAACTCGAGTTTACACTAGCCTCATGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163136.1-1067s21c1
Sequence:CCGGATCCACCAGCTGCTACTATTTCTCGAGAAATAGTAGCAGCTGGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163136.1-661s21c1
Sequence:CCGGCAAGGAGGGTCAGTCCAATTACTCGAGTAATTGGACTGACCCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163136
MACC1 MISSION shRNA shRNA Plasmid DNA
metastasis associated in colon cancer 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163136.1-1232s21c1
Sequence:CCGGACACATCTCCAGTCGTATTTCCTCGAGGAAATACGACTGGAGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163136.1-683s21c1
Sequence:CCGGCCGACTCAGACATCACTATTCCTCGAGGAATAGTGATGTCTGAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163136.1-2714s21c1
Sequence:CCGGTACCCATGAGGCTAGTGTAAACTCGAGTTTACACTAGCCTCATGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163136.1-1067s21c1
Sequence:CCGGATCCACCAGCTGCTACTATTTCTCGAGAAATAGTAGCAGCTGGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163136.1-661s21c1
Sequence:CCGGCAAGGAGGGTCAGTCCAATTACTCGAGTAATTGGACTGACCCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163136
MACC1 MISSION shRNA Lentiviral Transduction Particles
metastasis associated in colon cancer 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163136.1-1232s21c1
Sequence:CCGGACACATCTCCAGTCGTATTTCCTCGAGGAAATACGACTGGAGATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163136.1-683s21c1
Sequence:CCGGCCGACTCAGACATCACTATTCCTCGAGGAATAGTGATGTCTGAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163136.1-2714s21c1
Sequence:CCGGTACCCATGAGGCTAGTGTAAACTCGAGTTTACACTAGCCTCATGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163136.1-1067s21c1
Sequence:CCGGATCCACCAGCTGCTACTATTTCTCGAGAAATAGTAGCAGCTGGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163136.1-661s21c1
Sequence:CCGGCAAGGAGGGTCAGTCCAATTACTCGAGTAATTGGACTGACCCTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182762
MACC1 MISSION shRNA Bacterial Glycerol Stock
metastasis associated in colon cancer 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182762.3-6266s21c1
Sequence:CCGGGCGTGACTTAGGATAAGATTTCTCGAGAAATCTTATCCTAAGTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182762.3-466s21c1
Sequence:CCGGTTCACCCTTCGTGGTAATAATCTCGAGATTATTACCACGAAGGGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182762.3-794s21c1
Sequence:CCGGAGATCCTACTACACGACTTAGCTCGAGCTAAGTCGTGTAGTAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182762.3-969s21c1
Sequence:CCGGTCAAGGAGGGTCAGTACAATTCTCGAGAATTGTACTGACCCTCCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182762.3-1949s21c1
Sequence:CCGGCATTGAACTTTAGCAACTATGCTCGAGCATAGTTGCTAAAGTTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182762.1-2338s1c1
Sequence:CCGGGCTGTTGAGATGATGTGGAAACTCGAGTTTCCACATCATCTCAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182762.1-1804s1c1
Sequence:CCGGCTCAGAGGTAAGATTGGACTTCTCGAGAAGTCCAATCTTACCTCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182762
MACC1 MISSION shRNA shRNA Plasmid DNA
metastasis associated in colon cancer 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182762.3-6266s21c1
Sequence:CCGGGCGTGACTTAGGATAAGATTTCTCGAGAAATCTTATCCTAAGTCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182762.3-466s21c1
Sequence:CCGGTTCACCCTTCGTGGTAATAATCTCGAGATTATTACCACGAAGGGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182762.3-794s21c1
Sequence:CCGGAGATCCTACTACACGACTTAGCTCGAGCTAAGTCGTGTAGTAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182762.3-969s21c1
Sequence:CCGGTCAAGGAGGGTCAGTACAATTCTCGAGAATTGTACTGACCCTCCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182762.3-1949s21c1
Sequence:CCGGCATTGAACTTTAGCAACTATGCTCGAGCATAGTTGCTAAAGTTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182762.1-2338s1c1
Sequence:CCGGGCTGTTGAGATGATGTGGAAACTCGAGTTTCCACATCATCTCAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182762.1-1804s1c1
Sequence:CCGGCTCAGAGGTAAGATTGGACTTCTCGAGAAGTCCAATCTTACCTCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182762
MACC1 MISSION shRNA Lentiviral Transduction Particles
metastasis associated in colon cancer 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242546    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182762.3-6266s21c1
Sequence:CCGGGCGTGACTTAGGATAAGATTTCTCGAGAAATCTTATCCTAAGTCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182762.3-466s21c1
Sequence:CCGGTTCACCCTTCGTGGTAATAATCTCGAGATTATTACCACGAAGGGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182762.3-794s21c1
Sequence:CCGGAGATCCTACTACACGACTTAGCTCGAGCTAAGTCGTGTAGTAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182762.3-969s21c1
Sequence:CCGGTCAAGGAGGGTCAGTACAATTCTCGAGAATTGTACTGACCCTCCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182762.3-1949s21c1
Sequence:CCGGCATTGAACTTTAGCAACTATGCTCGAGCATAGTTGCTAAAGTTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182762.1-2338s1c1
Sequence:CCGGGCTGTTGAGATGATGTGGAAACTCGAGTTTCCACATCATCTCAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182762.1-1804s1c1
Sequence:CCGGCTCAGAGGTAAGATTGGACTTCTCGAGAAGTCCAATCTTACCTCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)