EMAIL THIS PAGE TO A FRIEND

MACF1

microtubule-actin crosslinking factor 1

206 Gene Product Result for
Synonyms: ABP620 ACF7 MACF OFC4
Gene ID:
Human(23499) Summary: This gene encodes a large protein containing numerous spectrin and leucine-rich repeat (LRR) domains. The encoded protein is a member of a family of proteins that form bridges between different cytoskeletal elements. This protein facilitates actin-microtubule interactions at the cell periphery and couples the microtubule network to cellular junctions. Alternative splicing results in multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, May 2013]
Mouse(11426) microtubule-actin crosslinking factor 1
Rat(362587) microtubule-actin crosslinking factor 1
Zebrafish(562190) microtubule-actin crosslinking factor 1
cow(506730) microtubule-actin crosslinking factor 1
Horse(100068727) microtubule-actin crosslinking factor 1
chicken(419671) microtubule-actin crosslinking factor 1
domestic cat(101095186) microtubule-actin crosslinking factor 1
dog(475321) microtubule-actin crosslinking factor 1
Domestic Rabbit(100341624) microtubule-actin crosslinking factor 1
naked mole-rat(101727047) microtubule-actin crosslinking factor 1
domestic guinea pig(100716782) microtubule-actin crosslinking factor 1
sheep(101118486) microtubule-actin crosslinking factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_110503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_110503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_110503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012090 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012090 Rosetta Predictions human pricing
NM_033044 Rosetta Predictions human pricing
XM_001055153 Rosetta Predictions rat pricing
XM_342906 Rosetta Predictions rat pricing
NM_009600 Rosetta Predictions mouse pricing
XM_884922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343586 predicted 5079
2 SASI_Hs01_00182881 predicted 9952
3 SASI_Hs02_00343587 predicted 8211
4 SASI_Hs01_00182882 predicted 6605
5 SASI_Hs01_00182883 predicted 7044
6 SASI_Hs01_00182884 predicted 16104
7 SASI_Hs01_00182885 predicted 11477
8 SASI_Hs02_00343588 predicted 16226
9 SASI_Hs02_00343589 predicted 13556
10 SASI_Hs02_00343590 predicted 9544
11 SASI_Hs01_00182880 predicted 9220
12 SASI_Hs01_00182886 predicted 10617
13 SASI_Hs01_00182887 predicted 13027
14 SASI_Hs01_00182888 predicted 16183
15 SASI_Hs01_00182889 predicted 9235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360728 predicted 6516
2 SASI_Hs01_00184147 predicted 11389
3 SASI_Hs02_00360729 predicted 9652
4 SASI_Hs01_00184148 predicted 8030
5 SASI_Hs01_00184149 predicted 8477
6 SASI_Hs01_00184150 predicted 17561
7 SASI_Hs01_00184151 predicted 12914
8 SASI_Hs01_00184152 predicted 17677
9 SASI_Hs02_00360730 predicted 14995
10 SASI_Hs02_00360731 predicted 10980
11 SASI_Hs01_00184146 predicted 10655
12 SASI_Hs01_00184153 predicted 12041
13 SASI_Hs01_00184154 predicted 14468
14 SASI_Hs01_00184155 predicted 17637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278626 predicted 4551
2 SASI_Rn02_00278627 predicted 2264
3 SASI_Rn02_00278628 predicted 11600
4 SASI_Rn02_00278629 predicted 7034
5 SASI_Rn02_00278630 predicted 14656
6 SASI_Rn02_00278631 predicted 12515
7 SASI_Rn02_00278632 predicted 4646
8 SASI_Rn02_00278633 predicted 4462
9 SASI_Rn02_00278634 predicted 2640
10 SASI_Rn02_00278635 predicted 10525
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395001 predicted 4554
2 SASI_Rn02_00395002 predicted 2271
3 SASI_Rn02_00395003 predicted 11599
4 SASI_Rn02_00395004 predicted 7032
5 SASI_Rn02_00395005 predicted 14654
6 SASI_Rn02_00395006 predicted 12520
7 SASI_Rn02_00395007 predicted 4651
8 SASI_Rn02_00395008 predicted 4468
9 SASI_Rn02_00395009 predicted 2643
10 SASI_Rn02_00395010 predicted 10528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316517 predicted 11561
2 SASI_Mm02_00316518 predicted 11443
3 SASI_Mm02_00316519 predicted 1987
4 SASI_Mm02_00316520 predicted 2944
5 SASI_Mm02_00316521 predicted 5919
6 SASI_Mm02_00316522 predicted 9166
7 SASI_Mm02_00316523 predicted 5215
8 SASI_Mm02_00316524 predicted 10572
9 SASI_Mm02_00316525 predicted 5666
10 SASI_Mm02_00316526 predicted 7362
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213231 predicted 17360
2 SASI_Mm01_00213232 predicted 17158
3 SASI_Mm01_00213233 predicted 17043
4 SASI_Mm01_00213234 predicted 1827
5 SASI_Mm01_00213235 predicted 20713
6 SASI_Mm01_00213236 predicted 15085
7 SASI_Mm01_00213237 predicted 303
8 SASI_Mm01_00213238 predicted 11602
9 SASI_Mm01_00213239 predicted 13287
10 SASI_Mm01_00213240 predicted 4042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_110503
VALIDATED
MACF1 MISSION shRNA Bacterial Glycerol Stock
microtubule-actin crosslinking factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110503.6-23807s1c1
Sequence:CCGGCGGTGTGTAAACTCTCTGTTTCTCGAGAAACAGAGAGTTTACACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110503.6-13940s1c1
Sequence:CCGGCCAGTGAGATTCGGTCTGATTCTCGAGAATCAGACCGAATCTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110503.6-22077s1c1
Sequence:CCGGCCAGGGTGAATTGATGTTAAACTCGAGTTTAACATCAATTCACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110503.6-8836s1c1
Sequence:CCGGCCTGAAAGTAAAGCACCGTTACTCGAGTAACGGTGCTTTACTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110503.6-6543s1c1
Sequence:CCGGCCTGAGATCATCCAAGAATTTCTCGAGAAATTCTTGGATGATCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_110503
VALIDATED
MACF1 MISSION shRNA shRNA Plasmid DNA
microtubule-actin crosslinking factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110503.6-23807s1c1
Sequence:CCGGCGGTGTGTAAACTCTCTGTTTCTCGAGAAACAGAGAGTTTACACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110503.6-13940s1c1
Sequence:CCGGCCAGTGAGATTCGGTCTGATTCTCGAGAATCAGACCGAATCTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110503.6-22077s1c1
Sequence:CCGGCCAGGGTGAATTGATGTTAAACTCGAGTTTAACATCAATTCACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110503.6-8836s1c1
Sequence:CCGGCCTGAAAGTAAAGCACCGTTACTCGAGTAACGGTGCTTTACTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110503.6-6543s1c1
Sequence:CCGGCCTGAGATCATCCAAGAATTTCTCGAGAAATTCTTGGATGATCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_110503
VALIDATED
MACF1 MISSION shRNA Lentiviral Transduction Particles
microtubule-actin crosslinking factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110503.6-23807s1c1
Sequence:CCGGCGGTGTGTAAACTCTCTGTTTCTCGAGAAACAGAGAGTTTACACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_110503.6-13940s1c1
Sequence:CCGGCCAGTGAGATTCGGTCTGATTCTCGAGAATCAGACCGAATCTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110503.6-22077s1c1
Sequence:CCGGCCAGGGTGAATTGATGTTAAACTCGAGTTTAACATCAATTCACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110503.6-8836s1c1
Sequence:CCGGCCTGAAAGTAAAGCACCGTTACTCGAGTAACGGTGCTTTACTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_110503.6-6543s1c1
Sequence:CCGGCCTGAGATCATCCAAGAATTTCTCGAGAAATTCTTGGATGATCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012090
VALIDATED
MACF1 MISSION shRNA Bacterial Glycerol Stock
microtubule-actin crosslinking factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012090.3-11862s1c1
Sequence:CCGGGCCCACAACTAAAGGAATTAACTCGAGTTAATTCCTTTAGTTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012090.3-10127s1c1
Sequence:CCGGGCTGAGTATAAAGTGGTGAAACTCGAGTTTCACCACTTTATACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012090.3-2276s1c1
Sequence:CCGGGCTGAGTTGATCTGGTTGAATCTCGAGATTCAACCAGATCAACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012090.3-15060s1c1
Sequence:CCGGCGCAGAACATTGACCGAGTTACTCGAGTAACTCGGTCAATGTTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012090.3-6000s1c1
Sequence:CCGGGCCAGTATCATCAATTCCAAACTCGAGTTTGGAATTGATGATACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012090.3-1357s21c1
Sequence:CCGGGATTGAATTTGGCCGAATTAACTCGAGTTAATTCGGCCAAATTCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_012090.3-1067s21c1
Sequence:CCGGACTTATGTGTCTTCGATTTATCTCGAGATAAATCGAAGACACATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_012090.3-16514s21c1
Sequence:CCGGCCCAAGCCACTATCCACTTTGCTCGAGCAAAGTGGATAGTGGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012090.3-11862s21c1
Sequence:CCGGGCCCACAACTAAAGGAATTAACTCGAGTTAATTCCTTTAGTTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_012090.3-2276s21c1
Sequence:CCGGGCTGAGTTGATCTGGTTGAATCTCGAGATTCAACCAGATCAACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012090
VALIDATED
MACF1 MISSION shRNA shRNA Plasmid DNA
microtubule-actin crosslinking factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012090.3-11862s1c1
Sequence:CCGGGCCCACAACTAAAGGAATTAACTCGAGTTAATTCCTTTAGTTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012090.3-10127s1c1
Sequence:CCGGGCTGAGTATAAAGTGGTGAAACTCGAGTTTCACCACTTTATACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012090.3-2276s1c1
Sequence:CCGGGCTGAGTTGATCTGGTTGAATCTCGAGATTCAACCAGATCAACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012090.3-15060s1c1
Sequence:CCGGCGCAGAACATTGACCGAGTTACTCGAGTAACTCGGTCAATGTTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012090.3-6000s1c1
Sequence:CCGGGCCAGTATCATCAATTCCAAACTCGAGTTTGGAATTGATGATACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012090.3-1357s21c1
Sequence:CCGGGATTGAATTTGGCCGAATTAACTCGAGTTAATTCGGCCAAATTCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_012090.3-1067s21c1
Sequence:CCGGACTTATGTGTCTTCGATTTATCTCGAGATAAATCGAAGACACATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_012090.3-16514s21c1
Sequence:CCGGCCCAAGCCACTATCCACTTTGCTCGAGCAAAGTGGATAGTGGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012090.3-11862s21c1
Sequence:CCGGGCCCACAACTAAAGGAATTAACTCGAGTTAATTCCTTTAGTTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_012090.3-2276s21c1
Sequence:CCGGGCTGAGTTGATCTGGTTGAATCTCGAGATTCAACCAGATCAACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012090
VALIDATED
MACF1 MISSION shRNA Lentiviral Transduction Particles
microtubule-actin crosslinking factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012090.3-11862s1c1
Sequence:CCGGGCCCACAACTAAAGGAATTAACTCGAGTTAATTCCTTTAGTTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012090.3-10127s1c1
Sequence:CCGGGCTGAGTATAAAGTGGTGAAACTCGAGTTTCACCACTTTATACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012090.3-2276s1c1
Sequence:CCGGGCTGAGTTGATCTGGTTGAATCTCGAGATTCAACCAGATCAACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012090.3-15060s1c1
Sequence:CCGGCGCAGAACATTGACCGAGTTACTCGAGTAACTCGGTCAATGTTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012090.3-6000s1c1
Sequence:CCGGGCCAGTATCATCAATTCCAAACTCGAGTTTGGAATTGATGATACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012090.3-1357s21c1
Sequence:CCGGGATTGAATTTGGCCGAATTAACTCGAGTTAATTCGGCCAAATTCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_012090.3-1067s21c1
Sequence:CCGGACTTATGTGTCTTCGATTTATCTCGAGATAAATCGAAGACACATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294071    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_012090.3-16514s21c1
Sequence:CCGGCCCAAGCCACTATCCACTTTGCTCGAGCAAAGTGGATAGTGGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_012090.3-11862s21c1
Sequence:CCGGGCCCACAACTAAAGGAATTAACTCGAGTTAATTCCTTTAGTTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_012090.3-2276s21c1
Sequence:CCGGGCTGAGTTGATCTGGTTGAATCTCGAGATTCAACCAGATCAACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)