EMAIL THIS PAGE TO A FRIEND

MACROD1

MACRO domain containing 1

52 Gene Product Result for
Synonyms: LRP16
UniProtKB ID: Q9BQ69, Q9UH96
Gene ID:
Mouse(107227) MACRO domain containing 1
Rat(246233) MACRO domain containing 1
Zebrafish(447834) MACRO domain containing 1
domestic cat(101091478) MACRO domain containing 1
cow(613568) MACRO domain containing 1
dog(612142) MACRO domain containing 1
Goat(100861314) MACRO domain containing 1
domestic guinea pig(100732197) MACRO domain containing 1
naked mole-rat(101705668) MACRO domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134147 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134147 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134147 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014067 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121551 MISSION® esiRNA esiRNA human MACROD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014067 Rosetta Predictions human pricing
NM_139337 Rosetta Predictions rat pricing
NM_134147 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236121 predicted 693
2 SASI_Hs01_00236122 predicted 486
3 SASI_Hs01_00236124 predicted 706
4 SASI_Hs01_00236125 predicted 660
5 SASI_Hs01_00236126 predicted 946
6 SASI_Hs01_00236127 predicted 887
7 SASI_Hs01_00236129 predicted 784
8 SASI_Hs01_00236130 predicted 960
9 SASI_Hs02_00345095 predicted 708
10 SASI_Hs02_00345096 predicted 527
11 SASI_Hs01_00236123 predicted 917
12 SASI_Hs01_00236128 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031233 predicted 435
2 SASI_Rn01_00031234 predicted 688
3 SASI_Rn02_00268598 predicted 425
4 SASI_Rn01_00031236 predicted 453
5 SASI_Rn01_00031237 predicted 372
6 SASI_Rn01_00031238 predicted 306
7 SASI_Rn01_00031239 predicted 440
8 SASI_Rn01_00031240 predicted 448
9 SASI_Rn01_00031241 predicted 677
10 SASI_Rn01_00031242 predicted 379
11 SASI_Rn01_00031235 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043988 predicted 381
2 SASI_Mm01_00043989 predicted 697
3 SASI_Mm01_00043990 predicted 1008
4 SASI_Mm01_00043992 predicted 551
5 SASI_Mm01_00043993 predicted 758
6 SASI_Mm01_00043994 predicted 450
7 SASI_Mm01_00043995 predicted 741
8 SASI_Mm01_00043996 predicted 396
9 SASI_Mm01_00043997 predicted 690
10 SASI_Mm02_00339414 predicted 438
11 SASI_Mm01_00043991 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134147
VALIDATED
MACROD1 MISSION shRNA Bacterial Glycerol Stock
MACRO domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134147.4-913s21c1
Sequence:CCGGTGCATCTCCACAGGCGTGTTTCTCGAGAAACACGCCTGTGGAGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134147.4-458s21c1
Sequence:CCGGACTTCTGCAAGGATTTCATTACTCGAGTAATGAAATCCTTGCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134147.4-556s21c1
Sequence:CCGGGACAAGCAACTGAATGAGAAACTCGAGTTTCTCATTCAGTTGCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134147.2-370s1c1
Sequence:CCGGCAAATCCTTTCTGAAGGGCCTCTCGAGAGGCCCTTCAGAAAGGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134147.2-1032s1c1
Sequence:CCGGCCCATTATTTCCCAGTAGCCTCTCGAGAGGCTACTGGGAAATAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134147.4-1098s21c1
Sequence:CCGGTTCCCACATCCCACCCTGAACCTCGAGGTTCAGGGTGGGATGTGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134147.4-763s21c1
Sequence:CCGGTATCGGCTGCCAGCCAAGTATCTCGAGATACTTGGCTGGCAGCCGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134147.2-410s1c1
Sequence:CCGGGAACATTACTTCTGCAAGGATCTCGAGATCCTTGCAGAAGTAATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134147.2-515s1c1
Sequence:CCGGGACAAGCAACTGAATGAGAAACTCGAGTTTCTCATTCAGTTGCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134147
VALIDATED
MACROD1 MISSION shRNA shRNA Plasmid DNA
MACRO domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134147.4-913s21c1
Sequence:CCGGTGCATCTCCACAGGCGTGTTTCTCGAGAAACACGCCTGTGGAGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134147.4-458s21c1
Sequence:CCGGACTTCTGCAAGGATTTCATTACTCGAGTAATGAAATCCTTGCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134147.4-556s21c1
Sequence:CCGGGACAAGCAACTGAATGAGAAACTCGAGTTTCTCATTCAGTTGCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134147.2-370s1c1
Sequence:CCGGCAAATCCTTTCTGAAGGGCCTCTCGAGAGGCCCTTCAGAAAGGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134147.2-1032s1c1
Sequence:CCGGCCCATTATTTCCCAGTAGCCTCTCGAGAGGCTACTGGGAAATAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134147.4-1098s21c1
Sequence:CCGGTTCCCACATCCCACCCTGAACCTCGAGGTTCAGGGTGGGATGTGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134147.4-763s21c1
Sequence:CCGGTATCGGCTGCCAGCCAAGTATCTCGAGATACTTGGCTGGCAGCCGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134147.2-410s1c1
Sequence:CCGGGAACATTACTTCTGCAAGGATCTCGAGATCCTTGCAGAAGTAATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134147.2-515s1c1
Sequence:CCGGGACAAGCAACTGAATGAGAAACTCGAGTTTCTCATTCAGTTGCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134147
VALIDATED
MACROD1 MISSION shRNA Lentiviral Transduction Particles
MACRO domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134147.4-913s21c1
Sequence:CCGGTGCATCTCCACAGGCGTGTTTCTCGAGAAACACGCCTGTGGAGATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134147.4-458s21c1
Sequence:CCGGACTTCTGCAAGGATTTCATTACTCGAGTAATGAAATCCTTGCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134147.4-556s21c1
Sequence:CCGGGACAAGCAACTGAATGAGAAACTCGAGTTTCTCATTCAGTTGCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134147.2-370s1c1
Sequence:CCGGCAAATCCTTTCTGAAGGGCCTCTCGAGAGGCCCTTCAGAAAGGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134147.2-1032s1c1
Sequence:CCGGCCCATTATTTCCCAGTAGCCTCTCGAGAGGCTACTGGGAAATAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134147.4-1098s21c1
Sequence:CCGGTTCCCACATCCCACCCTGAACCTCGAGGTTCAGGGTGGGATGTGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_134147.4-763s21c1
Sequence:CCGGTATCGGCTGCCAGCCAAGTATCTCGAGATACTTGGCTGGCAGCCGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134147.2-410s1c1
Sequence:CCGGGAACATTACTTCTGCAAGGATCTCGAGATCCTTGCAGAAGTAATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134147.2-515s1c1
Sequence:CCGGGACAAGCAACTGAATGAGAAACTCGAGTTTCTCATTCAGTTGCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014067
VALIDATED
MACROD1 MISSION shRNA Bacterial Glycerol Stock
MACRO domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-390s21c1
Sequence:CCGGATTACTTCTGCAAGGACTTTGCTCGAGCAAAGTCCTTGCAGAAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-974s21c1
Sequence:CCGGGAGAAGGACGAGGACATCTACCTCGAGGTAGATGTCCTCGTCCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014067.2-346s1c1
Sequence:CCGGGAAATCCTTTCTGAAGGGCCTCTCGAGAGGCCCTTCAGAAAGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014067.2-418s1c1
Sequence:CCGGGAAGAAGATCCCGACATGGAACTCGAGTTCCATGTCGGGATCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-432s21c1
Sequence:CCGGCATGGAAGGAGATGGCGAAAGCTCGAGCTTTCGCCATCTCCTTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-330s21c1
Sequence:CCGGCCGACTGGAAGGAGGCGAAATCTCGAGATTTCGCCTCCTTCCAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-467s21c1
Sequence:CCGGGTGGAGGAGCCCAGGTATAAACTCGAGTTTATACCTGGGCTCCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014067
VALIDATED
MACROD1 MISSION shRNA shRNA Plasmid DNA
MACRO domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-390s21c1
Sequence:CCGGATTACTTCTGCAAGGACTTTGCTCGAGCAAAGTCCTTGCAGAAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-974s21c1
Sequence:CCGGGAGAAGGACGAGGACATCTACCTCGAGGTAGATGTCCTCGTCCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014067.2-346s1c1
Sequence:CCGGGAAATCCTTTCTGAAGGGCCTCTCGAGAGGCCCTTCAGAAAGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014067.2-418s1c1
Sequence:CCGGGAAGAAGATCCCGACATGGAACTCGAGTTCCATGTCGGGATCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-432s21c1
Sequence:CCGGCATGGAAGGAGATGGCGAAAGCTCGAGCTTTCGCCATCTCCTTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-330s21c1
Sequence:CCGGCCGACTGGAAGGAGGCGAAATCTCGAGATTTCGCCTCCTTCCAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-467s21c1
Sequence:CCGGGTGGAGGAGCCCAGGTATAAACTCGAGTTTATACCTGGGCTCCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014067
VALIDATED
MACROD1 MISSION shRNA Lentiviral Transduction Particles
MACRO domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-390s21c1
Sequence:CCGGATTACTTCTGCAAGGACTTTGCTCGAGCAAAGTCCTTGCAGAAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-974s21c1
Sequence:CCGGGAGAAGGACGAGGACATCTACCTCGAGGTAGATGTCCTCGTCCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014067.2-346s1c1
Sequence:CCGGGAAATCCTTTCTGAAGGGCCTCTCGAGAGGCCCTTCAGAAAGGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014067.2-418s1c1
Sequence:CCGGGAAGAAGATCCCGACATGGAACTCGAGTTCCATGTCGGGATCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-432s21c1
Sequence:CCGGCATGGAAGGAGATGGCGAAAGCTCGAGCTTTCGCCATCTCCTTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-330s21c1
Sequence:CCGGCCGACTGGAAGGAGGCGAAATCTCGAGATTTCGCCTCCTTCCAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014067.2-467s21c1
Sequence:CCGGGTGGAGGAGCCCAGGTATAAACTCGAGTTTATACCTGGGCTCCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)