EMAIL THIS PAGE TO A FRIEND

MACROD2

MACRO domain containing 2

331 Gene Product Result for
Synonyms: C20orf133
Gene ID:
Mouse(72899) MACRO domain containing 2
Rat(685695) MACRO domain containing 2
naked mole-rat(101706933) MACRO domain containing 2
domestic guinea pig(100728169) MACRO domain containing 2
sheep(101105841) MACRO domain containing 2
Zebrafish(393521) MACRO domain containing 2
domestic cat(101096466) MACRO domain containing 2
cow(100125389) MACRO domain containing 2
dog(100688976) MACRO domain containing 2
chicken(770086) MACRO domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA049076 Anti-MACROD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080676 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006991 MISSION® esiRNA esiRNA targeting human C20orf133 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033086 Rosetta Predictions human pricing
NM_001033087 Rosetta Predictions human pricing
NM_080676 Rosetta Predictions human pricing
XM_001064879 Rosetta Predictions rat pricing
NM_001013802 Rosetta Predictions mouse pricing
NM_028387 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140117 predicted 1022
2 SASI_Hs01_00140118 predicted 1917
3 SASI_Hs01_00140119 predicted 1037
4 SASI_Hs01_00140120 predicted 1128
5 SASI_Hs01_00140121 predicted 1137
6 SASI_Hs01_00140122 predicted 1818
7 SASI_Hs01_00140123 predicted 974
8 SASI_Hs01_00140124 predicted 963
9 SASI_Hs01_00140125 predicted 1119
10 SASI_Hs01_00140126 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181213 predicted 639
2 SASI_Hs02_00307999 predicted 1599
3 SASI_Hs02_00308000 predicted 645
4 SASI_Hs01_00181217 predicted 746
5 SASI_Hs02_00308001 predicted 747
6 SASI_Hs01_00181211 predicted 1495
7 SASI_Hs02_00308002 predicted 580
8 SASI_Hs02_00308003 predicted 731
9 SASI_Hs01_00181220 predicted 724
10 SASI_Hs02_00308004 predicted 700
11 SASI_Hs01_00181212 predicted 829
12 SASI_Hs01_00181214 predicted 788
13 SASI_Hs01_00181215 predicted 1035
14 SASI_Hs01_00181216 predicted 1091
15 SASI_Hs01_00181218 predicted 811
16 SASI_Hs01_00181219 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362442 predicted 1147
2 SASI_Hs02_00362443 predicted 2040
3 SASI_Hs02_00362444 predicted 1147
4 SASI_Hs02_00362445 predicted 1248
5 SASI_Hs02_00362446 predicted 1260
6 SASI_Hs02_00362447 predicted 1932
7 SASI_Hs02_00362448 predicted 1091
8 SASI_Hs02_00362449 predicted 1240
9 SASI_Hs02_00362450 predicted 1232
10 SASI_Hs02_00362451 predicted 1212
11 SASI_Hs01_00022532 predicted 437
12 SASI_Hs01_00022533 predicted 225
13 SASI_Hs01_00022534 predicted 362
14 SASI_Hs01_00022535 predicted 399
15 SASI_Hs01_00022536 predicted 366
16 SASI_Hs01_00022537 predicted 210
17 SASI_Hs01_00022538 predicted 385
18 SASI_Hs01_00022539 predicted 472
19 SASI_Hs01_00022540 predicted 305
20 SASI_Hs01_00022541 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064879 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312084 predicted 203
2 SASI_Rn02_00312085 predicted 29
3 SASI_Rn02_00312086 predicted 302
4 SASI_Rn02_00312087 predicted 181
5 SASI_Rn02_00312088 predicted 194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013802 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151721 predicted 1060
2 SASI_Mm01_00151723 predicted 1430
3 SASI_Mm02_00287365 predicted 670
4 SASI_Mm02_00287366 predicted 909
5 SASI_Mm01_00151727 predicted 1072
6 SASI_Mm02_00287367 predicted 507
7 SASI_Mm02_00287368 predicted 966
8 SASI_Mm02_00287369 predicted 286
9 SASI_Mm02_00287370 predicted 840
10 SASI_Mm01_00151729 predicted 1456
11 SASI_Mm01_00151722 predicted 625
12 SASI_Mm01_00151724 predicted 1500
13 SASI_Mm01_00151725 predicted 509
14 SASI_Mm01_00151726 predicted 468
15 SASI_Mm01_00151728 predicted 637
16 SASI_Mm01_00151730 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071433 predicted 879
2 SASI_Mm01_00071434 predicted 862
3 SASI_Mm01_00071436 predicted 1093
4 SASI_Mm01_00071439 predicted 1002
5 SASI_Mm02_00333763 predicted 928
6 SASI_Mm02_00333764 predicted 1101
7 SASI_Mm01_00071442 predicted 831
8 SASI_Mm02_00333765 predicted 1121
9 SASI_Mm02_00333766 predicted 982
10 SASI_Mm02_00333767 predicted 880
11 SASI_Mm01_00071435 predicted 572
12 SASI_Mm01_00071437 predicted 841
13 SASI_Mm01_00071438 predicted 428
14 SASI_Mm01_00071440 predicted 477
15 SASI_Mm01_00071441 predicted 496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028387
MACROD2 MISSION shRNA Bacterial Glycerol Stock
MACRO domain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028387.1-523s1c1
Sequence:CCGGGCCCTTTATCTGATCTTGTTTCTCGAGAAACAAGATCAGATAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028387.1-581s1c1
Sequence:CCGGCTCCTTGAGAAGAGTCTGTTTCTCGAGAAACAGACTCTTCTCAAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184452    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028387.1-1434s1c1
Sequence:CCGGGCAGCAGTTATGTCACGTCTACTCGAGTAGACGTGACATAACTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028387.1-734s21c1
Sequence:CCGGTGAGAACTGAGAAGGTATTAACTCGAGTTAATACCTTCTCAGTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028387.1-690s21c1
Sequence:CCGGTTTGTTGCGTGTCTAACTAACCTCGAGGTTAGTTAGACACGCAACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028387.1-1753s21c1
Sequence:CCGGACGTTTCCTGCTAGGATATATCTCGAGATATATCCTAGCAGGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028387.1-641s21c1
Sequence:CCGGTGAACTTCCTGAAGGCAAACACTCGAGTGTTTGCCTTCAGGAAGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028387.1-664s21c1
Sequence:CCGGCAAGAAGGGTGGGAGACACATCTCGAGATGTGTCTCCCACCCTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028387
MACROD2 MISSION shRNA shRNA Plasmid DNA
MACRO domain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028387.1-523s1c1
Sequence:CCGGGCCCTTTATCTGATCTTGTTTCTCGAGAAACAAGATCAGATAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028387.1-581s1c1
Sequence:CCGGCTCCTTGAGAAGAGTCTGTTTCTCGAGAAACAGACTCTTCTCAAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184452    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028387.1-1434s1c1
Sequence:CCGGGCAGCAGTTATGTCACGTCTACTCGAGTAGACGTGACATAACTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028387.1-734s21c1
Sequence:CCGGTGAGAACTGAGAAGGTATTAACTCGAGTTAATACCTTCTCAGTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028387.1-690s21c1
Sequence:CCGGTTTGTTGCGTGTCTAACTAACCTCGAGGTTAGTTAGACACGCAACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028387.1-1753s21c1
Sequence:CCGGACGTTTCCTGCTAGGATATATCTCGAGATATATCCTAGCAGGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028387.1-641s21c1
Sequence:CCGGTGAACTTCCTGAAGGCAAACACTCGAGTGTTTGCCTTCAGGAAGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028387.1-664s21c1
Sequence:CCGGCAAGAAGGGTGGGAGACACATCTCGAGATGTGTCTCCCACCCTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028387
MACROD2 MISSION shRNA Lentiviral Transduction Particles
MACRO domain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028387.1-523s1c1
Sequence:CCGGGCCCTTTATCTGATCTTGTTTCTCGAGAAACAAGATCAGATAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028387.1-581s1c1
Sequence:CCGGCTCCTTGAGAAGAGTCTGTTTCTCGAGAAACAGACTCTTCTCAAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184452    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028387.1-1434s1c1
Sequence:CCGGGCAGCAGTTATGTCACGTCTACTCGAGTAGACGTGACATAACTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028387.1-734s21c1
Sequence:CCGGTGAGAACTGAGAAGGTATTAACTCGAGTTAATACCTTCTCAGTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028387.1-690s21c1
Sequence:CCGGTTTGTTGCGTGTCTAACTAACCTCGAGGTTAGTTAGACACGCAACAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028387.1-1753s21c1
Sequence:CCGGACGTTTCCTGCTAGGATATATCTCGAGATATATCCTAGCAGGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028387.1-641s21c1
Sequence:CCGGTGAACTTCCTGAAGGCAAACACTCGAGTGTTTGCCTTCAGGAAGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028387.1-664s21c1
Sequence:CCGGCAAGAAGGGTGGGAGACACATCTCGAGATGTGTCTCCCACCCTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080676
MACROD2 MISSION shRNA Bacterial Glycerol Stock
MACRO domain containing 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080676.2-720s1c1
Sequence:CCGGGCTTCCATTTCATCCAAGGATCTCGAGATCCTTGGATGAAATGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080676.5-905s21c1
Sequence:CCGGATGAGGTGGATCGGATCATTTCTCGAGAAATGATCCGATCCACCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080676.5-1769s21c1
Sequence:CCGGACGCATCTTTCAGGCATTATCCTCGAGGATAATGCCTGAAAGATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080676.5-1293s21c1
Sequence:CCGGAGAATCGCAGAGCTCATATATCTCGAGATATATGAGCTCTGCGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080676.5-349s21c1
Sequence:CCGGGAATACCTAAGAGACTATATTCTCGAGAATATAGTCTCTTAGGTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080676.5-981s21c1
Sequence:CCGGTTTCTCCGTAGACGATAATAACTCGAGTTATTATCGTCTACGGAGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080676
MACROD2 MISSION shRNA shRNA Plasmid DNA
MACRO domain containing 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080676.2-720s1c1
Sequence:CCGGGCTTCCATTTCATCCAAGGATCTCGAGATCCTTGGATGAAATGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080676.5-905s21c1
Sequence:CCGGATGAGGTGGATCGGATCATTTCTCGAGAAATGATCCGATCCACCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080676.5-1769s21c1
Sequence:CCGGACGCATCTTTCAGGCATTATCCTCGAGGATAATGCCTGAAAGATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080676.5-1293s21c1
Sequence:CCGGAGAATCGCAGAGCTCATATATCTCGAGATATATGAGCTCTGCGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080676.5-349s21c1
Sequence:CCGGGAATACCTAAGAGACTATATTCTCGAGAATATAGTCTCTTAGGTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080676.5-981s21c1
Sequence:CCGGTTTCTCCGTAGACGATAATAACTCGAGTTATTATCGTCTACGGAGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080676
MACROD2 MISSION shRNA Lentiviral Transduction Particles
MACRO domain containing 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179566    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080676.2-720s1c1
Sequence:CCGGGCTTCCATTTCATCCAAGGATCTCGAGATCCTTGGATGAAATGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080676.5-905s21c1
Sequence:CCGGATGAGGTGGATCGGATCATTTCTCGAGAAATGATCCGATCCACCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244143    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080676.5-1769s21c1
Sequence:CCGGACGCATCTTTCAGGCATTATCCTCGAGGATAATGCCTGAAAGATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080676.5-1293s21c1
Sequence:CCGGAGAATCGCAGAGCTCATATATCTCGAGATATATGAGCTCTGCGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080676.5-349s21c1
Sequence:CCGGGAATACCTAAGAGACTATATTCTCGAGAATATAGTCTCTTAGGTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080676.5-981s21c1
Sequence:CCGGTTTCTCCGTAGACGATAATAACTCGAGTTATTATCGTCTACGGAGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)