EMAIL THIS PAGE TO A FRIEND

MAD2L1BP

MAD2L1 binding protein

61 Gene Product Result for
Synonyms: CMT2 RP1-261G23.6
UniProtKB ID: Q15013, B4DLV3, E9PAT7, Q6IBB1
Gene ID:
Human(9587) Summary: The protein encoded by this gene was identified as a binding protein of the MAD2 mitotic arrest deficient-like 1 (MAD2/MAD2L1). MAD2 is a key component of the spindle checkpoint that delays the onset of anaphase until all the kinetochores are attached to the spindle. This protein may interact with the spindle checkpoint and coordinate cell cycle events in late mitosis. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(66591) MAD2L1 binding protein
Rat(316237) MAD2L1 binding protein
sheep(101115833) MAD2L1 binding protein
domestic guinea pig(100731857) MAD2L1 binding protein
naked mole-rat(101708522) MAD2L1 binding protein
chicken(421448) MAD2L1 binding protein
cow(615542) MAD2L1 binding protein
domestic cat(101089189) MAD2L1 binding protein
dog(474916) MAD2L1 binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014628 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003690 Rosetta Predictions human pricing
NM_014628 Rosetta Predictions human pricing
NM_001009699 Rosetta Predictions rat pricing
NM_025649 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222303 predicted 851
2 SASI_Hs01_00222304 predicted 667
3 SASI_Hs01_00222305 predicted 1117
4 SASI_Hs01_00222306 predicted 956
5 SASI_Hs01_00222307 predicted 1018
6 SASI_Hs01_00222308 predicted 1231
7 SASI_Hs01_00222309 predicted 871
8 SASI_Hs01_00222310 predicted 571
9 SASI_Hs01_00222311 predicted 1193
10 SASI_Hs01_00222312 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163504 predicted 577
2 SASI_Hs01_00163505 predicted 403
3 SASI_Hs01_00163506 predicted 848
4 SASI_Hs01_00163507 predicted 689
5 SASI_Hs01_00163508 predicted 753
6 SASI_Hs01_00163509 predicted 971
7 SASI_Hs01_00163510 predicted 607
8 SASI_Hs01_00163511 predicted 303
9 SASI_Hs01_00163512 predicted 921
10 SASI_Hs01_00163513 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048432 predicted 827
2 SASI_Rn01_00048433 predicted 446
3 SASI_Rn01_00048434 predicted 213
4 SASI_Rn01_00048435 predicted 672
5 SASI_Rn01_00048436 predicted 226
6 SASI_Rn01_00048437 predicted 981
7 SASI_Rn01_00048438 predicted 845
8 SASI_Rn01_00048439 predicted 295
9 SASI_Rn01_00048440 predicted 871
10 SASI_Rn01_00048441 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136295 predicted 511
2 SASI_Mm01_00136296 predicted 975
3 SASI_Mm01_00136297 predicted 841
4 SASI_Mm01_00136298 predicted 319
5 SASI_Mm01_00136299 predicted 607
6 SASI_Mm01_00136300 predicted 518
7 SASI_Mm01_00136301 predicted 672
8 SASI_Mm01_00136302 predicted 243
9 SASI_Mm02_00328765 predicted 251
10 SASI_Mm01_00136304 predicted 657
11 SASI_Mm01_00136303 predicted 406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014628
MAD2L1BP MISSION shRNA Bacterial Glycerol Stock
MAD2L1 binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014628.2-473s21c1
Sequence:CCGGTAGTACCGCGAGTGCTGATTCCTCGAGGAATCAGCACTCGCGGTACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014628.2-856s21c1
Sequence:CCGGGAGTGAATGAGTGCTTCTTAACTCGAGTTAAGAAGCACTCATTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-319s1c1
Sequence:CCGGGAGGAGATGCTGAAGAAGAAACTCGAGTTTCTTCTTCAGCATCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-678s1c1
Sequence:CCGGGTTTCGACCCAAGCTCAACTACTCGAGTAGTTGAGCTTGGGTCGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014628.2-1103s21c1
Sequence:CCGGTGGGTCAGGCATTTCTATTAGCTCGAGCTAATAGAAATGCCTGACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014628.2-249s21c1
Sequence:CCGGGTTTACTTGTGAACTTCTAAACTCGAGTTTAGAAGTTCACAAGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-97s1c1
Sequence:CCGGGAACTACTTGAGACAAGCTCTCTCGAGAGAGCTTGTCTCAAGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-85s1c1
Sequence:CCGGGCCTCCCAGATAGAACTACTTCTCGAGAAGTAGTTCTATCTGGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-119s1c1
Sequence:CCGGCGCAGGAACCTCTCAACGCTTCTCGAGAAGCGTTGAGAGGTTCCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-266s1c1
Sequence:CCGGCTCTGCCCTATGAACAGCTTACTCGAGTAAGCTGTTCATAGGGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014628
MAD2L1BP MISSION shRNA shRNA Plasmid DNA
MAD2L1 binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014628.2-473s21c1
Sequence:CCGGTAGTACCGCGAGTGCTGATTCCTCGAGGAATCAGCACTCGCGGTACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014628.2-856s21c1
Sequence:CCGGGAGTGAATGAGTGCTTCTTAACTCGAGTTAAGAAGCACTCATTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-319s1c1
Sequence:CCGGGAGGAGATGCTGAAGAAGAAACTCGAGTTTCTTCTTCAGCATCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-678s1c1
Sequence:CCGGGTTTCGACCCAAGCTCAACTACTCGAGTAGTTGAGCTTGGGTCGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014628.2-1103s21c1
Sequence:CCGGTGGGTCAGGCATTTCTATTAGCTCGAGCTAATAGAAATGCCTGACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014628.2-249s21c1
Sequence:CCGGGTTTACTTGTGAACTTCTAAACTCGAGTTTAGAAGTTCACAAGTAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-97s1c1
Sequence:CCGGGAACTACTTGAGACAAGCTCTCTCGAGAGAGCTTGTCTCAAGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-85s1c1
Sequence:CCGGGCCTCCCAGATAGAACTACTTCTCGAGAAGTAGTTCTATCTGGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-119s1c1
Sequence:CCGGCGCAGGAACCTCTCAACGCTTCTCGAGAAGCGTTGAGAGGTTCCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-266s1c1
Sequence:CCGGCTCTGCCCTATGAACAGCTTACTCGAGTAAGCTGTTCATAGGGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014628
MAD2L1BP MISSION shRNA Lentiviral Transduction Particles
MAD2L1 binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014628.2-473s21c1
Sequence:CCGGTAGTACCGCGAGTGCTGATTCCTCGAGGAATCAGCACTCGCGGTACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014628.2-856s21c1
Sequence:CCGGGAGTGAATGAGTGCTTCTTAACTCGAGTTAAGAAGCACTCATTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-319s1c1
Sequence:CCGGGAGGAGATGCTGAAGAAGAAACTCGAGTTTCTTCTTCAGCATCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-678s1c1
Sequence:CCGGGTTTCGACCCAAGCTCAACTACTCGAGTAGTTGAGCTTGGGTCGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014628.2-1103s21c1
Sequence:CCGGTGGGTCAGGCATTTCTATTAGCTCGAGCTAATAGAAATGCCTGACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014628.2-249s21c1
Sequence:CCGGGTTTACTTGTGAACTTCTAAACTCGAGTTTAGAAGTTCACAAGTAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-97s1c1
Sequence:CCGGGAACTACTTGAGACAAGCTCTCTCGAGAGAGCTTGTCTCAAGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-85s1c1
Sequence:CCGGGCCTCCCAGATAGAACTACTTCTCGAGAAGTAGTTCTATCTGGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-119s1c1
Sequence:CCGGCGCAGGAACCTCTCAACGCTTCTCGAGAAGCGTTGAGAGGTTCCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014628.1-266s1c1
Sequence:CCGGCTCTGCCCTATGAACAGCTTACTCGAGTAAGCTGTTCATAGGGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025649
VALIDATED
MAD2L1BP MISSION shRNA Bacterial Glycerol Stock
MAD2L1 binding protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025649.3-824s21c1
Sequence:CCGGTGGCTTCAGAGGATTACATTTCTCGAGAAATGTAATCCTCTGAAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025649.3-881s21c1
Sequence:CCGGAGTGAAGGTATAAGGACAATGCTCGAGCATTGTCCTTATACCTTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025649.1-329s1c1
Sequence:CCGGCTGAAGCACTTCTACCGGAAACTCGAGTTTCCGGTAGAAGTGCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025649.1-101s1c1
Sequence:CCGGGATTGGTATGAGAAGCCGGAACTCGAGTTCCGGCTTCTCATACCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025649.1-845s1c1
Sequence:CCGGGTGACACTTAAAGGTTTCCATCTCGAGATGGAAACCTTTAAGTGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025649.1-1015s1c1
Sequence:CCGGGTGATAATTGTCATCAAGCAACTCGAGTTGCTTGATGACAATTATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025649.1-488s1c1
Sequence:CCGGCCACAAGTGTTGATCCTTCTTCTCGAGAAGAAGGATCAACACTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025649.3-1097s21c1
Sequence:CCGGGATCTGTTTGGGAGTAGAAAGCTCGAGCTTTCTACTCCCAAACAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025649
VALIDATED
MAD2L1BP MISSION shRNA shRNA Plasmid DNA
MAD2L1 binding protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025649.3-824s21c1
Sequence:CCGGTGGCTTCAGAGGATTACATTTCTCGAGAAATGTAATCCTCTGAAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025649.3-881s21c1
Sequence:CCGGAGTGAAGGTATAAGGACAATGCTCGAGCATTGTCCTTATACCTTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025649.1-329s1c1
Sequence:CCGGCTGAAGCACTTCTACCGGAAACTCGAGTTTCCGGTAGAAGTGCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025649.1-101s1c1
Sequence:CCGGGATTGGTATGAGAAGCCGGAACTCGAGTTCCGGCTTCTCATACCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025649.1-845s1c1
Sequence:CCGGGTGACACTTAAAGGTTTCCATCTCGAGATGGAAACCTTTAAGTGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025649.1-1015s1c1
Sequence:CCGGGTGATAATTGTCATCAAGCAACTCGAGTTGCTTGATGACAATTATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025649.1-488s1c1
Sequence:CCGGCCACAAGTGTTGATCCTTCTTCTCGAGAAGAAGGATCAACACTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025649.3-1097s21c1
Sequence:CCGGGATCTGTTTGGGAGTAGAAAGCTCGAGCTTTCTACTCCCAAACAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025649
VALIDATED
MAD2L1BP MISSION shRNA Lentiviral Transduction Particles
MAD2L1 binding protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025649.3-824s21c1
Sequence:CCGGTGGCTTCAGAGGATTACATTTCTCGAGAAATGTAATCCTCTGAAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025649.3-881s21c1
Sequence:CCGGAGTGAAGGTATAAGGACAATGCTCGAGCATTGTCCTTATACCTTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025649.1-329s1c1
Sequence:CCGGCTGAAGCACTTCTACCGGAAACTCGAGTTTCCGGTAGAAGTGCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025649.1-101s1c1
Sequence:CCGGGATTGGTATGAGAAGCCGGAACTCGAGTTCCGGCTTCTCATACCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025649.1-845s1c1
Sequence:CCGGGTGACACTTAAAGGTTTCCATCTCGAGATGGAAACCTTTAAGTGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025649.1-1015s1c1
Sequence:CCGGGTGATAATTGTCATCAAGCAACTCGAGTTGCTTGATGACAATTATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025649.1-488s1c1
Sequence:CCGGCCACAAGTGTTGATCCTTCTTCTCGAGAAGAAGGATCAACACTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025649.3-1097s21c1
Sequence:CCGGGATCTGTTTGGGAGTAGAAAGCTCGAGCTTTCTACTCCCAAACAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)