EMAIL THIS PAGE TO A FRIEND

MAD2L2

MAD2 mitotic arrest deficient-like 2 (yeast)

77 Gene Product Result for
Synonyms: MAD2B POLZ2 REV7
UniProtKB ID: Q9UI95, B3KNE3, Q5TGW7, Q9UNA7, Q9Y6I6
Gene ID:
Human(10459) Summary: The protein encoded by this gene is a component of the mitotic spindle assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate. The encoded protein, which is similar to MAD2L1, is capable of interacting with ADAM9, ADAM15, REV1, and REV3 proteins. [provided by RefSeq, Jul 2008]
Mouse(71890) MAD2 mitotic arrest deficient-like 2
Rat(313702) MAD2 mitotic arrest deficient-like 2 (yeast)
chicken(419493) MAD2 mitotic arrest deficient-like 2 (yeast)
cow(506605) MAD2 mitotic arrest deficient-like 2 (yeast)
domestic cat(101099643) MAD2 mitotic arrest deficient-like 2 (yeast)
dog(487443) MAD2 mitotic arrest deficient-like 2 (yeast)
naked mole-rat(101721329) MAD2 mitotic arrest deficient-like 2 (yeast)
domestic guinea pig(100716735) MAD2 mitotic arrest deficient-like 2 (yeast)
sheep(101112078) MAD2 mitotic arrest deficient-like 2 (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU081101 MISSION® esiRNA esiRNA targeting mouse Mad2l2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127325 Rosetta Predictions human pricing
NM_006341 Rosetta Predictions human pricing
NM_001012106 Rosetta Predictions rat pricing
XM_575957 Rosetta Predictions rat pricing
NM_027985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329127 predicted 544
2 SASI_Hs02_00329128 predicted 824
3 SASI_Hs02_00329129 predicted 824
4 SASI_Hs02_00329130 predicted 555
5 SASI_Hs02_00329131 predicted 427
6 SASI_Hs02_00329132 predicted 877
7 SASI_Hs02_00329133 predicted 868
8 SASI_Hs02_00329134 predicted 701
9 SASI_Hs02_00329135 predicted 835
10 SASI_Hs02_00329136 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049554 predicted 514
2 SASI_Hs01_00049555 predicted 788
3 SASI_Hs01_00049556 predicted 791
4 SASI_Hs01_00049557 predicted 520
5 SASI_Hs01_00049558 predicted 390
6 SASI_Hs01_00049559 predicted 847
7 SASI_Hs01_00049560 predicted 835
8 SASI_Hs01_00049561 predicted 670
9 SASI_Hs02_00341375 predicted 797
10 SASI_Hs01_00049562 predicted 611
11 SASI_Hs01_00049563 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117670 predicted 416
2 SASI_Rn01_00117671 predicted 498
3 SASI_Rn01_00117672 predicted 921
4 SASI_Rn01_00117673 predicted 273
5 SASI_Rn01_00117674 predicted 382
6 SASI_Rn01_00117675 predicted 576
7 SASI_Rn01_00117676 predicted 914
8 SASI_Rn01_00117677 predicted 803
9 SASI_Rn01_00117678 predicted 549
10 SASI_Rn01_00117679 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172323 predicted 643
2 SASI_Rn01_00172324 predicted 786
3 SASI_Rn01_00172325 predicted 773
4 SASI_Rn01_00172326 predicted 668
5 SASI_Rn01_00172327 predicted 661
6 SASI_Rn01_00172328 predicted 776
7 SASI_Rn01_00172329 predicted 701
8 SASI_Rn01_00172330 predicted 791
9 SASI_Rn01_00172331 predicted 673
10 SASI_Rn01_00172332 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025628 predicted 698
2 SASI_Mm01_00025629 predicted 670
3 SASI_Mm01_00025630 predicted 903
4 SASI_Mm01_00025631 predicted 901
5 SASI_Mm01_00025632 predicted 949
6 SASI_Mm01_00025633 predicted 794
7 SASI_Mm02_00333037 predicted 767
8 SASI_Mm01_00025634 predicted 812
9 SASI_Mm01_00025635 predicted 904
10 SASI_Mm01_00025637 predicted 442
11 SASI_Mm01_00025636 predicted 770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006341
MAD2L2 MISSION shRNA Bacterial Glycerol Stock
MAD2 mitotic arrest deficient-like 2 (yeast)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006341.2-390s1c1
Sequence:CCGGCCCAGTGGAGAAATTCGTCTTCTCGAGAAGACGAATTTCTCCACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006341.2-282s1c1
Sequence:CCGGCCCGGAGCTGAATCAGTATATCTCGAGATATACTGATTCAGCTCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006341.2-826s1c1
Sequence:CCGGCCCTGATTCCAAGTGCTCTTACTCGAGTAAGAGCACTTGGAATCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006341.2-231s1c1
Sequence:CCGGCATCTTCCAGAAACGCAAGAACTCGAGTTCTTGCGTTTCTGGAAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006341.2-579s1c1
Sequence:CCGGCACTCGCAACATGGAGAAGATCTCGAGATCTTCTCCATGTTGCGAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006341.3-407s21c1
Sequence:CCGGACTCCTGGAGAAGAATGATGTCTCGAGACATCATTCTTCTCCAGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006341
MAD2L2 MISSION shRNA shRNA Plasmid DNA
MAD2 mitotic arrest deficient-like 2 (yeast)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006341.2-390s1c1
Sequence:CCGGCCCAGTGGAGAAATTCGTCTTCTCGAGAAGACGAATTTCTCCACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006341.2-282s1c1
Sequence:CCGGCCCGGAGCTGAATCAGTATATCTCGAGATATACTGATTCAGCTCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006341.2-826s1c1
Sequence:CCGGCCCTGATTCCAAGTGCTCTTACTCGAGTAAGAGCACTTGGAATCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006341.2-231s1c1
Sequence:CCGGCATCTTCCAGAAACGCAAGAACTCGAGTTCTTGCGTTTCTGGAAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006341.2-579s1c1
Sequence:CCGGCACTCGCAACATGGAGAAGATCTCGAGATCTTCTCCATGTTGCGAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006341.3-407s21c1
Sequence:CCGGACTCCTGGAGAAGAATGATGTCTCGAGACATCATTCTTCTCCAGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006341
MAD2L2 MISSION shRNA Lentiviral Transduction Particles
MAD2 mitotic arrest deficient-like 2 (yeast)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006341.2-390s1c1
Sequence:CCGGCCCAGTGGAGAAATTCGTCTTCTCGAGAAGACGAATTTCTCCACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006341.2-282s1c1
Sequence:CCGGCCCGGAGCTGAATCAGTATATCTCGAGATATACTGATTCAGCTCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006341.2-826s1c1
Sequence:CCGGCCCTGATTCCAAGTGCTCTTACTCGAGTAAGAGCACTTGGAATCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006341.2-231s1c1
Sequence:CCGGCATCTTCCAGAAACGCAAGAACTCGAGTTCTTGCGTTTCTGGAAGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006341.2-579s1c1
Sequence:CCGGCACTCGCAACATGGAGAAGATCTCGAGATCTTCTCCATGTTGCGAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006341.3-407s21c1
Sequence:CCGGACTCCTGGAGAAGAATGATGTCTCGAGACATCATTCTTCTCCAGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027985
VALIDATED
MAD2L2 MISSION shRNA Bacterial Glycerol Stock
MAD2 mitotic arrest deficient-like 2 (yeast)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027985.1-586s1c1
Sequence:CCGGCCAGTGGAGAAGTTTGTCTTTCTCGAGAAAGACAAACTTCTCCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027985.1-792s1c1
Sequence:CCGGGATACAGGTCATCAAGGACTTCTCGAGAAGTCCTTGATGACCTGTATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027985.1-1000s1c1
Sequence:CCGGCCAGACTCCAAGTGCTCTTATCTCGAGATAAGAGCACTTGGAGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027985.1-426s1c1
Sequence:CCGGCATCTTCCAGAAGCGCAAGAACTCGAGTTCTTGCGCTTCTGGAAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027985.1-676s1c1
Sequence:CCGGCGAGCCTTCATCCTTAAGATTCTCGAGAATCTTAAGGATGAAGGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027985.2-425s21c1
Sequence:CCGGCATCTTCCAGAAGCGCAAGAACTCGAGTTCTTGCGCTTCTGGAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027985.2-999s21c1
Sequence:CCGGCCAGACTCCAAGTGCTCTTATCTCGAGATAAGAGCACTTGGAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027985.2-585s21c1
Sequence:CCGGCCAGTGGAGAAGTTTGTCTTTCTCGAGAAAGACAAACTTCTCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027985.2-791s21c1
Sequence:CCGGGATACAGGTCATCAAGGACTTCTCGAGAAGTCCTTGATGACCTGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027985.2-675s21c1
Sequence:CCGGCGAGCCTTCATCCTTAAGATTCTCGAGAATCTTAAGGATGAAGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027985
VALIDATED
MAD2L2 MISSION shRNA shRNA Plasmid DNA
MAD2 mitotic arrest deficient-like 2 (yeast)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027985.1-586s1c1
Sequence:CCGGCCAGTGGAGAAGTTTGTCTTTCTCGAGAAAGACAAACTTCTCCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027985.1-792s1c1
Sequence:CCGGGATACAGGTCATCAAGGACTTCTCGAGAAGTCCTTGATGACCTGTATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027985.1-1000s1c1
Sequence:CCGGCCAGACTCCAAGTGCTCTTATCTCGAGATAAGAGCACTTGGAGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027985.1-426s1c1
Sequence:CCGGCATCTTCCAGAAGCGCAAGAACTCGAGTTCTTGCGCTTCTGGAAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027985.1-676s1c1
Sequence:CCGGCGAGCCTTCATCCTTAAGATTCTCGAGAATCTTAAGGATGAAGGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027985.2-425s21c1
Sequence:CCGGCATCTTCCAGAAGCGCAAGAACTCGAGTTCTTGCGCTTCTGGAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027985.2-999s21c1
Sequence:CCGGCCAGACTCCAAGTGCTCTTATCTCGAGATAAGAGCACTTGGAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027985.2-585s21c1
Sequence:CCGGCCAGTGGAGAAGTTTGTCTTTCTCGAGAAAGACAAACTTCTCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027985.2-791s21c1
Sequence:CCGGGATACAGGTCATCAAGGACTTCTCGAGAAGTCCTTGATGACCTGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027985.2-675s21c1
Sequence:CCGGCGAGCCTTCATCCTTAAGATTCTCGAGAATCTTAAGGATGAAGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027985
VALIDATED
MAD2L2 MISSION shRNA Lentiviral Transduction Particles
MAD2 mitotic arrest deficient-like 2 (yeast)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027985.1-586s1c1
Sequence:CCGGCCAGTGGAGAAGTTTGTCTTTCTCGAGAAAGACAAACTTCTCCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027985.1-792s1c1
Sequence:CCGGGATACAGGTCATCAAGGACTTCTCGAGAAGTCCTTGATGACCTGTATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027985.1-1000s1c1
Sequence:CCGGCCAGACTCCAAGTGCTCTTATCTCGAGATAAGAGCACTTGGAGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027985.1-426s1c1
Sequence:CCGGCATCTTCCAGAAGCGCAAGAACTCGAGTTCTTGCGCTTCTGGAAGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027985.1-676s1c1
Sequence:CCGGCGAGCCTTCATCCTTAAGATTCTCGAGAATCTTAAGGATGAAGGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027985.2-425s21c1
Sequence:CCGGCATCTTCCAGAAGCGCAAGAACTCGAGTTCTTGCGCTTCTGGAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027985.2-999s21c1
Sequence:CCGGCCAGACTCCAAGTGCTCTTATCTCGAGATAAGAGCACTTGGAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027985.2-585s21c1
Sequence:CCGGCCAGTGGAGAAGTTTGTCTTTCTCGAGAAAGACAAACTTCTCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027985.2-791s21c1
Sequence:CCGGGATACAGGTCATCAAGGACTTCTCGAGAAGTCCTTGATGACCTGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027985.2-675s21c1
Sequence:CCGGCGAGCCTTCATCCTTAAGATTCTCGAGAATCTTAAGGATGAAGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)