EMAIL THIS PAGE TO A FRIEND

MADCAM1

mucosal vascular addressin cell adhesion molecule 1

67 Gene Product Result for
Synonyms: MACAM1
UniProtKB ID: Q13477, A5PKV4, B2RPL9, O60222, O75867
Gene ID:
Human(8174) Summary: The protein encoded by this gene is an endothelial cell adhesion molecule that interacts preferentially with the leukocyte beta7 integrin LPAM-1 (alpha4beta7), L-selectin, and VLA-4 (alpha4beta1) on myeloid cells to direct leukocytes into mucosal and inflamed tissues. It is a member of the immunoglobulin family and is similar to ICAM1 and VCAM1. At least seven alternatively spliced transcripts encoding different protein isoforms have been found for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(17123) mucosal vascular addressin cell adhesion molecule 1
Rat(54266) mucosal vascular addressin cell adhesion molecule 1
domestic guinea pig(100722478) mucosal vascular addressin cell adhesion molecule 1
naked mole-rat(101723568) mucosal vascular addressin cell adhesion molecule 1
chicken(100858236) mucosal vascular addressin cell adhesion molecule 1
cow(527275) mucosal vascular addressin cell adhesion molecule 1
dog(485103) mucosal vascular addressin cell adhesion molecule 1
domestic cat(101089986) mucosal vascular addressin cell adhesion molecule 1
cow(789849) mucosal vascular addressin cell adhesion molecule 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107781 Anti-MADCAM1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4301022 Anti-MADCAM1 antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130760 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU044761 MISSION® esiRNA esiRNA targeting mouse Madcam1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130760 Rosetta Predictions human pricing
NM_130761 Rosetta Predictions human pricing
NM_130762 Rosetta Predictions human pricing
NM_019317 Rosetta Predictions rat pricing
NM_013591 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142004 predicted 403
2 SASI_Hs01_00142005 predicted 399
3 SASI_Hs01_00142006 predicted 228
4 SASI_Hs01_00142007 predicted 396
5 SASI_Hs01_00142008 predicted 322
6 SASI_Hs01_00142009 predicted 349
7 SASI_Hs01_00142010 predicted 316
8 SASI_Hs01_00142011 predicted 406
9 SASI_Hs01_00142012 predicted 443
10 SASI_Hs01_00142013 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246387 predicted 411
2 SASI_Hs01_00246388 predicted 411
3 SASI_Hs01_00246389 predicted 231
4 SASI_Hs01_00246390 predicted 405
5 SASI_Hs01_00246391 predicted 323
6 SASI_Hs01_00246392 predicted 356
7 SASI_Hs01_00246393 predicted 324
8 SASI_Hs01_00246394 predicted 403
9 SASI_Hs01_00246395 predicted 444
10 SASI_Hs01_00246396 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115839 predicted 397
2 SASI_Hs01_00115840 predicted 404
3 SASI_Hs01_00115841 predicted 224
4 SASI_Hs01_00115842 predicted 399
5 SASI_Hs01_00115843 predicted 320
6 SASI_Hs01_00115844 predicted 350
7 SASI_Hs01_00115845 predicted 318
8 SASI_Hs01_00115846 predicted 402
9 SASI_Hs01_00115847 predicted 436
10 SASI_Hs01_00115848 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019317 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111261 predicted 499
2 SASI_Rn01_00111263 predicted 649
3 SASI_Rn02_00262284 predicted 608
4 SASI_Rn01_00111264 predicted 623
5 SASI_Rn01_00111265 predicted 660
6 SASI_Rn02_00262285 predicted 301
7 SASI_Rn01_00111266 predicted 724
8 SASI_Rn01_00111267 predicted 709
9 SASI_Rn01_00111268 predicted 916
10 SASI_Rn01_00111269 predicted 662
11 SASI_Rn01_00111262 predicted 435
12 SASI_Rn01_00111270 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107383 predicted 331
2 SASI_Mm01_00107384 predicted 736
3 SASI_Mm01_00107385 predicted 684
4 SASI_Mm01_00107386 predicted 440
5 SASI_Mm01_00107387 predicted 643
6 SASI_Mm01_00107388 predicted 784
7 SASI_Mm01_00107389 predicted 639
8 SASI_Mm01_00107390 predicted 1159
9 SASI_Mm01_00107391 predicted 915
10 SASI_Mm01_00107392 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130760
MADCAM1 MISSION shRNA Bacterial Glycerol Stock
mucosal vascular addressin cell adhesion molecule 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-1073s1c1
Sequence:CCGGCCACCAGCTTCTCTGAGGCTTCTCGAGAAGCCTCAGAGAAGCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-448s1c1
Sequence:CCGGGCTCTCCTTCTCCCTGCTCGTCTCGAGACGAGCAGGGAGAAGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-912s1c1
Sequence:CCGGCGCAGGGAGAAGTGATCCCAACTCGAGTTGGGATCACTTCTCCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-330s1c1
Sequence:CCGGTGCAGCTCCTTGTGTACGCCTCTCGAGAGGCGTACACAAGGAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-1019s1c1
Sequence:CCGGCCCACGTATCACCTCTGGAAACTCGAGTTTCCAGAGGTGATACGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130760
MADCAM1 MISSION shRNA shRNA Plasmid DNA
mucosal vascular addressin cell adhesion molecule 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-1073s1c1
Sequence:CCGGCCACCAGCTTCTCTGAGGCTTCTCGAGAAGCCTCAGAGAAGCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-448s1c1
Sequence:CCGGGCTCTCCTTCTCCCTGCTCGTCTCGAGACGAGCAGGGAGAAGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-912s1c1
Sequence:CCGGCGCAGGGAGAAGTGATCCCAACTCGAGTTGGGATCACTTCTCCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-330s1c1
Sequence:CCGGTGCAGCTCCTTGTGTACGCCTCTCGAGAGGCGTACACAAGGAGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-1019s1c1
Sequence:CCGGCCCACGTATCACCTCTGGAAACTCGAGTTTCCAGAGGTGATACGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130760
MADCAM1 MISSION shRNA Lentiviral Transduction Particles
mucosal vascular addressin cell adhesion molecule 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-1073s1c1
Sequence:CCGGCCACCAGCTTCTCTGAGGCTTCTCGAGAAGCCTCAGAGAAGCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-448s1c1
Sequence:CCGGGCTCTCCTTCTCCCTGCTCGTCTCGAGACGAGCAGGGAGAAGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-912s1c1
Sequence:CCGGCGCAGGGAGAAGTGATCCCAACTCGAGTTGGGATCACTTCTCCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-330s1c1
Sequence:CCGGTGCAGCTCCTTGTGTACGCCTCTCGAGAGGCGTACACAAGGAGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130760.1-1019s1c1
Sequence:CCGGCCCACGTATCACCTCTGGAAACTCGAGTTTCCAGAGGTGATACGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013591
MADCAM1 MISSION shRNA Bacterial Glycerol Stock
mucosal vascular addressin cell adhesion molecule 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-660s1c1
Sequence:CCGGGCTGACCCATAGAAAGGAGATCTCGAGATCTCCTTTCTATGGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-520s1c1
Sequence:CCGGCCAGAGCAAGAAGAGGAGATACTCGAGTATCTCCTCTTCTTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-337s1c1
Sequence:CCGGTCCGTGAAGATCCTTGTGTATCTCGAGATACACAAGGATCTTCACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-1217s1c1
Sequence:CCGGGCCCAGACACTAGCTCATGTACTCGAGTACATGAGCTAGTGTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-960s1c1
Sequence:CCGGCGACCTGGCAACCTACCACAACTCGAGTTGTGGTAGGTTGCCAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013591
MADCAM1 MISSION shRNA shRNA Plasmid DNA
mucosal vascular addressin cell adhesion molecule 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-660s1c1
Sequence:CCGGGCTGACCCATAGAAAGGAGATCTCGAGATCTCCTTTCTATGGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-520s1c1
Sequence:CCGGCCAGAGCAAGAAGAGGAGATACTCGAGTATCTCCTCTTCTTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-337s1c1
Sequence:CCGGTCCGTGAAGATCCTTGTGTATCTCGAGATACACAAGGATCTTCACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-1217s1c1
Sequence:CCGGGCCCAGACACTAGCTCATGTACTCGAGTACATGAGCTAGTGTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-960s1c1
Sequence:CCGGCGACCTGGCAACCTACCACAACTCGAGTTGTGGTAGGTTGCCAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013591
MADCAM1 MISSION shRNA Lentiviral Transduction Particles
mucosal vascular addressin cell adhesion molecule 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-660s1c1
Sequence:CCGGGCTGACCCATAGAAAGGAGATCTCGAGATCTCCTTTCTATGGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-520s1c1
Sequence:CCGGCCAGAGCAAGAAGAGGAGATACTCGAGTATCTCCTCTTCTTGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-337s1c1
Sequence:CCGGTCCGTGAAGATCCTTGTGTATCTCGAGATACACAAGGATCTTCACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-1217s1c1
Sequence:CCGGGCCCAGACACTAGCTCATGTACTCGAGTACATGAGCTAGTGTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013591.1-960s1c1
Sequence:CCGGCGACCTGGCAACCTACCACAACTCGAGTTGTGGTAGGTTGCCAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)