EMAIL THIS PAGE TO A FRIEND

MADD

MAP-kinase activating death domain

171 Gene Product Result for
Synonyms: DENN IG20 RAB3GEP
Gene ID:
Human(8567) Summary: Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(228355) MAP-kinase activating death domain
Rat(94193) MAP-kinase activating death domain
Zebrafish(100150917) MAP-kinase activating death domain
cow(534306) MAP-kinase activating death domain
Horse(100051327) MAP-kinase activating death domain
domestic cat(101093297) MAP-kinase activating death domain
dog(475982) MAP-kinase activating death domain
chicken(423184) MAP-kinase activating death domain
naked mole-rat(101710698) MAP-kinase activating death domain
domestic guinea pig(100725450) MAP-kinase activating death domain
sheep(101117276) MAP-kinase activating death domain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS1150 Anti-MADD antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
M5683 Anti-MADD antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
microarray, western blot pricing
SAB4503421 Anti-MADD antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA038568 Anti-MADD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145527 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145527 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145527 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003682 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003682 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003682 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003682 Rosetta Predictions human pricing
NM_130470 Rosetta Predictions human pricing
NM_130471 Rosetta Predictions human pricing
NM_130472 Rosetta Predictions human pricing
NM_130473 Rosetta Predictions human pricing
NM_130474 Rosetta Predictions human pricing
NM_130475 Rosetta Predictions human pricing
NM_130476 Rosetta Predictions human pricing
NM_053585 Rosetta Predictions rat pricing
NM_145527 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177629 predicted 2086
2 SASI_Hs01_00177630 predicted 455
3 SASI_Hs01_00177632 predicted 4635
4 SASI_Hs01_00177633 predicted 1904
5 SASI_Hs01_00177634 predicted 566
6 SASI_Hs01_00177635 predicted 759
7 SASI_Hs01_00177636 predicted 4321
8 SASI_Hs01_00177637 predicted 2150
9 SASI_Hs02_00336088 predicted 3188
10 SASI_Hs01_00177638 predicted 1980
11 SASI_Hs01_00177631 predicted 1945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137251 predicted 2217
2 SASI_Hs01_00137252 predicted 585
3 SASI_Hs01_00137254 predicted 2043
4 SASI_Hs01_00137255 predicted 702
5 SASI_Hs01_00137256 predicted 891
6 SASI_Hs01_00137257 predicted 3288
7 SASI_Hs01_00137258 predicted 4278
8 SASI_Hs01_00137259 predicted 2288
9 SASI_Hs02_00362767 predicted 3261
10 SASI_Hs01_00137260 predicted 2105
11 SASI_Hs01_00137253 predicted 2075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086280 predicted 2091
2 SASI_Hs01_00086281 predicted 458
3 SASI_Hs01_00086283 predicted 4389
4 SASI_Hs01_00086284 predicted 1910
5 SASI_Hs01_00086285 predicted 568
6 SASI_Hs01_00086286 predicted 755
7 SASI_Hs01_00086287 predicted 4083
8 SASI_Hs01_00086288 predicted 2149
9 SASI_Hs02_00362768 predicted 3058
10 SASI_Hs01_00086289 predicted 1971
11 SASI_Hs01_00086282 predicted 1944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219956 predicted 2082
2 SASI_Hs01_00219957 predicted 451
3 SASI_Hs01_00219960 predicted 1911
4 SASI_Hs01_00219961 predicted 564
5 SASI_Hs01_00219962 predicted 752
6 SASI_Hs02_00362769 predicted 3021
7 SASI_Hs01_00219963 predicted 4015
8 SASI_Hs01_00219964 predicted 2149
9 SASI_Hs02_00362770 predicted 2997
10 SASI_Hs01_00219965 predicted 1979
11 SASI_Hs01_00219958 predicted 1947
12 SASI_Hs01_00219959 predicted 4329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074811 predicted 2091
2 SASI_Hs01_00074812 predicted 450
3 SASI_Hs02_00362771 predicted 4513
4 SASI_Hs01_00074814 predicted 1911
5 SASI_Hs01_00074815 predicted 565
6 SASI_Hs01_00074816 predicted 754
7 SASI_Hs01_00074818 predicted 4210
8 SASI_Hs01_00074819 predicted 2146
9 SASI_Hs02_00362772 predicted 3192
10 SASI_Hs01_00074820 predicted 1972
11 SASI_Hs01_00074813 predicted 1941
12 SASI_Hs01_00074817 predicted 3217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189098 predicted 2089
2 SASI_Hs01_00189099 predicted 453
3 SASI_Hs01_00189101 predicted 1904
4 SASI_Hs01_00189102 predicted 565
5 SASI_Hs01_00189103 predicted 758
6 SASI_Hs01_00189104 predicted 3030
7 SASI_Hs01_00189105 predicted 4022
8 SASI_Hs01_00189106 predicted 2147
9 SASI_Hs02_00362773 predicted 2999
10 SASI_Hs01_00189107 predicted 1975
11 SASI_Hs01_00189100 predicted 1938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130475 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120746 predicted 2096
2 SASI_Hs01_00120747 predicted 463
3 SASI_Hs02_00362774 predicted 4647
4 SASI_Hs01_00120749 predicted 1915
5 SASI_Hs01_00120750 predicted 574
6 SASI_Hs01_00120751 predicted 772
7 SASI_Hs01_00120753 predicted 4340
8 SASI_Hs01_00120754 predicted 2159
9 SASI_Hs02_00362775 predicted 3199
10 SASI_Hs01_00120755 predicted 1982
11 SASI_Hs01_00120748 predicted 1950
12 SASI_Hs01_00120752 predicted 3236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095368 predicted 2098
2 SASI_Hs01_00095369 predicted 464
3 SASI_Hs02_00362776 predicted 4464
4 SASI_Hs01_00095371 predicted 1920
5 SASI_Hs01_00095372 predicted 576
6 SASI_Hs01_00095373 predicted 764
7 SASI_Hs01_00095375 predicted 4155
8 SASI_Hs01_00095376 predicted 2163
9 SASI_Hs02_00362777 predicted 3141
10 SASI_Hs01_00095377 predicted 1982
11 SASI_Hs01_00095370 predicted 1957
12 SASI_Hs01_00095374 predicted 3168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061846 predicted 2859
2 SASI_Rn01_00061847 predicted 4400
3 SASI_Rn01_00061849 predicted 3850
4 SASI_Rn01_00061850 predicted 1875
5 SASI_Rn01_00061851 predicted 4188
6 SASI_Rn01_00061852 predicted 1581
7 SASI_Rn01_00061853 predicted 4489
8 SASI_Rn01_00061854 predicted 2108
9 SASI_Rn01_00061855 predicted 4501
10 SASI_Rn02_00266255 predicted 454
11 SASI_Rn01_00061848 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195604 predicted 2125
2 SASI_Mm01_00195610 predicted 1686
3 SASI_Mm01_00195605 predicted 1124
4 SASI_Mm01_00195608 predicted 1982
5 SASI_Mm01_00195609 predicted 1971
6 SASI_Mm01_00195611 predicted 4634
7 SASI_Mm01_00195612 predicted 4330
8 SASI_Mm02_00341007 predicted 4542
9 SASI_Mm01_00195613 predicted 4400
10 SASI_Mm02_00341008 predicted 1955
11 SASI_Mm01_00195606 predicted 1046
12 SASI_Mm01_00195607 predicted 2586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145527
MADD MISSION shRNA Bacterial Glycerol Stock
MAP-kinase activating death domain
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145527.2-4136s1c1
Sequence:CCGGGCTGTAATGTTGGAAAGAGAACTCGAGTTCTCTTTCCAACATTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145527.3-1128s21c1
Sequence:CCGGTCGATTCACCCTAGTAGATTTCTCGAGAAATCTACTAGGGTGAATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145527.2-4928s1c1
Sequence:CCGGCCACAAGTACAAGACGCCAATCTCGAGATTGGCGTCTTGTACTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145527.2-1574s1c1
Sequence:CCGGCCGCTCATTTATGGCAATGATCTCGAGATCATTGCCATAAATGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145527.2-1915s1c1
Sequence:CCGGGCCCATCCATTATCGAGTCTACTCGAGTAGACTCGATAATGGATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145527.2-2797s1c1
Sequence:CCGGCCTGAAAGTATTTGGGCTAAACTCGAGTTTAGCCCAAATACTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145527.3-1896s21c1
Sequence:CCGGGACCCAAGCTGTGGAGTATTTCTCGAGAAATACTCCACAGCTTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145527.3-4028s21c1
Sequence:CCGGACGTAAGCCAGCGAGTCTATCCTCGAGGATAGACTCGCTGGCTTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145527.3-3332s21c1
Sequence:CCGGTTGCCCAGACCCACTACTATACTCGAGTATAGTAGTGGGTCTGGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145527
MADD MISSION shRNA shRNA Plasmid DNA
MAP-kinase activating death domain
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145527.2-4136s1c1
Sequence:CCGGGCTGTAATGTTGGAAAGAGAACTCGAGTTCTCTTTCCAACATTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145527.3-1128s21c1
Sequence:CCGGTCGATTCACCCTAGTAGATTTCTCGAGAAATCTACTAGGGTGAATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145527.2-4928s1c1
Sequence:CCGGCCACAAGTACAAGACGCCAATCTCGAGATTGGCGTCTTGTACTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145527.2-1574s1c1
Sequence:CCGGCCGCTCATTTATGGCAATGATCTCGAGATCATTGCCATAAATGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145527.2-1915s1c1
Sequence:CCGGGCCCATCCATTATCGAGTCTACTCGAGTAGACTCGATAATGGATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145527.2-2797s1c1
Sequence:CCGGCCTGAAAGTATTTGGGCTAAACTCGAGTTTAGCCCAAATACTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145527.3-1896s21c1
Sequence:CCGGGACCCAAGCTGTGGAGTATTTCTCGAGAAATACTCCACAGCTTGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145527.3-4028s21c1
Sequence:CCGGACGTAAGCCAGCGAGTCTATCCTCGAGGATAGACTCGCTGGCTTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145527.3-3332s21c1
Sequence:CCGGTTGCCCAGACCCACTACTATACTCGAGTATAGTAGTGGGTCTGGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145527
MADD MISSION shRNA Lentiviral Transduction Particles
MAP-kinase activating death domain
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145527.2-4136s1c1
Sequence:CCGGGCTGTAATGTTGGAAAGAGAACTCGAGTTCTCTTTCCAACATTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145527.3-1128s21c1
Sequence:CCGGTCGATTCACCCTAGTAGATTTCTCGAGAAATCTACTAGGGTGAATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145527.2-4928s1c1
Sequence:CCGGCCACAAGTACAAGACGCCAATCTCGAGATTGGCGTCTTGTACTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145527.2-1574s1c1
Sequence:CCGGCCGCTCATTTATGGCAATGATCTCGAGATCATTGCCATAAATGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145527.2-1915s1c1
Sequence:CCGGGCCCATCCATTATCGAGTCTACTCGAGTAGACTCGATAATGGATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145527.2-2797s1c1
Sequence:CCGGCCTGAAAGTATTTGGGCTAAACTCGAGTTTAGCCCAAATACTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145527.3-1896s21c1
Sequence:CCGGGACCCAAGCTGTGGAGTATTTCTCGAGAAATACTCCACAGCTTGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145527.3-4028s21c1
Sequence:CCGGACGTAAGCCAGCGAGTCTATCCTCGAGGATAGACTCGCTGGCTTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145527.3-3332s21c1
Sequence:CCGGTTGCCCAGACCCACTACTATACTCGAGTATAGTAGTGGGTCTGGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003682
VALIDATED
MADD MISSION shRNA Bacterial Glycerol Stock
MAP-kinase activating death domain
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-1513s1c1
Sequence:CCGGCCATCCTCAATCTGGAGAAATCTCGAGATTTCTCCAGATTGAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-4709s1c1
Sequence:CCGGGCTCAACAAGTTCTATACTAACTCGAGTTAGTATAGAACTTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-2486s1c1
Sequence:CCGGGCGAATCTATGACAATCCATACTCGAGTATGGATTGTCATAGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-4226s1c1
Sequence:CCGGCCAGGAAATGATCGACAGGTACTCGAGTACCTGTCGATCATTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-5009s1c1
Sequence:CCGGCCACAAGTACAAGACACCAATCTCGAGATTGGTGTCTTGTACTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-1055s21c1
Sequence:CCGGTCGATTCACCCTAGTGGATTTCTCGAGAAATCCACTAGGGTGAATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-1218s21c1
Sequence:CCGGATCTACCCACTGGAGTATATGCTCGAGCATATACTCCAGTGGGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-5391s21c1
Sequence:CCGGGCCGGTGTGAACCCACTATTTCTCGAGAAATAGTGGGTTCACACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-3319s21c1
Sequence:CCGGTTGCCCAGACCCACTACTATACTCGAGTATAGTAGTGGGTCTGGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-5037s21c1
Sequence:CCGGGAAATCTGCTACTCCGTATTACTCGAGTAATACGGAGTAGCAGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003682
VALIDATED
MADD MISSION shRNA shRNA Plasmid DNA
MAP-kinase activating death domain
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-1513s1c1
Sequence:CCGGCCATCCTCAATCTGGAGAAATCTCGAGATTTCTCCAGATTGAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-4709s1c1
Sequence:CCGGGCTCAACAAGTTCTATACTAACTCGAGTTAGTATAGAACTTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-2486s1c1
Sequence:CCGGGCGAATCTATGACAATCCATACTCGAGTATGGATTGTCATAGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-4226s1c1
Sequence:CCGGCCAGGAAATGATCGACAGGTACTCGAGTACCTGTCGATCATTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-5009s1c1
Sequence:CCGGCCACAAGTACAAGACACCAATCTCGAGATTGGTGTCTTGTACTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-1055s21c1
Sequence:CCGGTCGATTCACCCTAGTGGATTTCTCGAGAAATCCACTAGGGTGAATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-1218s21c1
Sequence:CCGGATCTACCCACTGGAGTATATGCTCGAGCATATACTCCAGTGGGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-5391s21c1
Sequence:CCGGGCCGGTGTGAACCCACTATTTCTCGAGAAATAGTGGGTTCACACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-3319s21c1
Sequence:CCGGTTGCCCAGACCCACTACTATACTCGAGTATAGTAGTGGGTCTGGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-5037s21c1
Sequence:CCGGGAAATCTGCTACTCCGTATTACTCGAGTAATACGGAGTAGCAGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003682
VALIDATED
MADD MISSION shRNA Lentiviral Transduction Particles
MAP-kinase activating death domain
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-1513s1c1
Sequence:CCGGCCATCCTCAATCTGGAGAAATCTCGAGATTTCTCCAGATTGAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-4709s1c1
Sequence:CCGGGCTCAACAAGTTCTATACTAACTCGAGTTAGTATAGAACTTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-2486s1c1
Sequence:CCGGGCGAATCTATGACAATCCATACTCGAGTATGGATTGTCATAGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-4226s1c1
Sequence:CCGGCCAGGAAATGATCGACAGGTACTCGAGTACCTGTCGATCATTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003682.2-5009s1c1
Sequence:CCGGCCACAAGTACAAGACACCAATCTCGAGATTGGTGTCTTGTACTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-1055s21c1
Sequence:CCGGTCGATTCACCCTAGTGGATTTCTCGAGAAATCCACTAGGGTGAATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-1218s21c1
Sequence:CCGGATCTACCCACTGGAGTATATGCTCGAGCATATACTCCAGTGGGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-5391s21c1
Sequence:CCGGGCCGGTGTGAACCCACTATTTCTCGAGAAATAGTGGGTTCACACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-3319s21c1
Sequence:CCGGTTGCCCAGACCCACTACTATACTCGAGTATAGTAGTGGGTCTGGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003682.2-5037s21c1
Sequence:CCGGGAAATCTGCTACTCCGTATTACTCGAGTAATACGGAGTAGCAGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)