EMAIL THIS PAGE TO A FRIEND

MAEA

macrophage erythroblast attacher

109 Gene Product Result for
Synonyms: EMLP EMP GID9 HLC-10 PIG5
Gene ID:
Human(10296) Summary: This gene product mediates the attachment of erythroblasts to macrophages. This attachment promotes terminal maturation and enucleation of erythroblasts, presumably by suppressing apoptosis. This protein is an integral membrane protein with the N-terminus on the extracellular side and the C-terminus on the cytoplasmic side of the cell. Two immunologically related isoforms of erythroblast macrophage protein with apparent molecular weights of 33 kD and 36 kD were detected in macrophage membranes; this gene encodes the larger isoform. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(59003) macrophage erythroblast attacher
Rat(298982) macrophage erythroblast attacher
Zebrafish(321575) macrophage erythroblast attacher
cow(511956) macrophage erythroblast attacher
domestic cat(101081889) macrophage erythroblast attacher
dog(610745) macrophage erythroblast attacher
chicken(426024) macrophage erythroblast attacher
domestic guinea pig(100719481) macrophage erythroblast attacher
naked mole-rat(101717857) macrophage erythroblast attacher
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005882 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017405 Rosetta Predictions human pricing
NM_005882 Rosetta Predictions human pricing
NM_001008319 Rosetta Predictions rat pricing
NM_021500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124428 predicted 1152
2 SASI_Hs02_00306735 predicted 1432
3 SASI_Hs01_00124429 predicted 1311
4 SASI_Hs01_00124430 predicted 1701
5 SASI_Hs01_00124431 predicted 1331
6 SASI_Hs02_00306736 predicted 1460
7 SASI_Hs01_00124432 predicted 1507
8 SASI_Hs01_00124433 predicted 855
9 SASI_Hs01_00124435 predicted 1488
10 SASI_Hs02_00306737 predicted 1376
11 SASI_Hs01_00124427 predicted 1170
12 SASI_Hs01_00124434 predicted 1339
13 SASI_Hs01_00124436 predicted 1509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137712 predicted 1026
2 SASI_Hs02_00340475 predicted 1306
3 SASI_Hs01_00137713 predicted 1181
4 SASI_Hs01_00137714 predicted 1578
5 SASI_Hs01_00137715 predicted 1204
6 SASI_Hs02_00340476 predicted 1330
7 SASI_Hs01_00137716 predicted 1379
8 SASI_Hs01_00137717 predicted 728
9 SASI_Hs01_00137719 predicted 1365
10 SASI_Hs02_00340477 predicted 1250
11 SASI_Hs01_00137711 predicted 1046
12 SASI_Hs01_00137718 predicted 1221
13 SASI_Hs01_00137720 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088389 predicted 599
2 SASI_Rn01_00088391 predicted 423
3 SASI_Rn01_00088392 predicted 1069
4 SASI_Rn01_00088393 predicted 1138
5 SASI_Rn01_00088394 predicted 744
6 SASI_Rn01_00088396 predicted 596
7 SASI_Rn01_00088398 predicted 836
8 SASI_Rn02_00199055 predicted 408
9 SASI_Rn02_00199056 predicted 1163
10 SASI_Rn02_00199057 predicted 1090
11 SASI_Rn01_00088390 predicted 448
12 SASI_Rn01_00088395 predicted 1108
13 SASI_Rn01_00088397 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030562 predicted 599
2 SASI_Mm01_00030564 predicted 408
3 SASI_Mm02_00326203 predicted 598
4 SASI_Mm02_00326204 predicted 1140
5 SASI_Mm02_00326205 predicted 1098
6 SASI_Mm01_00030569 predicted 1079
7 SASI_Mm02_00326206 predicted 423
8 SASI_Mm02_00326207 predicted 839
9 SASI_Mm02_00326208 predicted 378
10 SASI_Mm02_00326209 predicted 1124
11 SASI_Mm01_00030560 predicted 918
12 SASI_Mm01_00030561 predicted 503
13 SASI_Mm01_00030563 predicted 1025
14 SASI_Mm01_00030565 predicted 640
15 SASI_Mm01_00030566 predicted 1056
16 SASI_Mm01_00030567 predicted 365
17 SASI_Mm01_00030568 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021500
VALIDATED
MAEA MISSION shRNA Bacterial Glycerol Stock
macrophage erythroblast attacher
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021500.2-1104s21c1
Sequence:CCGGCTGCTTTCTATTCGTCAAGATCTCGAGATCTTGACGAATAGAAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021500.2-1169s21c1
Sequence:CCGGCCAAGCTGAGAAAGTATACATCTCGAGATGTATACTTTCTCAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021500.2-293s21c1
Sequence:CCGGCAAGCTCTGCAAACGTAGGATCTCGAGATCCTACGTTTGCAGAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021500.2-1520s21c1
Sequence:CCGGGAATTGGTTCATCGGTTATTTCTCGAGAAATAACCGATGAACCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021500.2-801s21c1
Sequence:CCGGCTGATCCAGCAGTTTCGATATCTCGAGATATCGAAACTGCTGGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021500.1-255s1c1
Sequence:CCGGCAAGCTCTGCAAACGTAGGATCTCGAGATCCTACGTTTGCAGAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021500.1-621s1c1
Sequence:CCGGGAGACATGCAAGAAAGCACTTCTCGAGAAGTGCTTTCTTGCATGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021500.1-1131s1c1
Sequence:CCGGCCAAGCTGAGAAAGTATACATCTCGAGATGTATACTTTCTCAGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021500.1-1066s1c1
Sequence:CCGGCTGCTTTCTATTCGTCAAGATCTCGAGATCTTGACGAATAGAAAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021500
VALIDATED
MAEA MISSION shRNA shRNA Plasmid DNA
macrophage erythroblast attacher
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021500.2-1104s21c1
Sequence:CCGGCTGCTTTCTATTCGTCAAGATCTCGAGATCTTGACGAATAGAAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021500.2-1169s21c1
Sequence:CCGGCCAAGCTGAGAAAGTATACATCTCGAGATGTATACTTTCTCAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021500.2-293s21c1
Sequence:CCGGCAAGCTCTGCAAACGTAGGATCTCGAGATCCTACGTTTGCAGAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021500.2-1520s21c1
Sequence:CCGGGAATTGGTTCATCGGTTATTTCTCGAGAAATAACCGATGAACCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021500.2-801s21c1
Sequence:CCGGCTGATCCAGCAGTTTCGATATCTCGAGATATCGAAACTGCTGGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021500.1-255s1c1
Sequence:CCGGCAAGCTCTGCAAACGTAGGATCTCGAGATCCTACGTTTGCAGAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021500.1-621s1c1
Sequence:CCGGGAGACATGCAAGAAAGCACTTCTCGAGAAGTGCTTTCTTGCATGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021500.1-1131s1c1
Sequence:CCGGCCAAGCTGAGAAAGTATACATCTCGAGATGTATACTTTCTCAGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021500.1-1066s1c1
Sequence:CCGGCTGCTTTCTATTCGTCAAGATCTCGAGATCTTGACGAATAGAAAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021500
VALIDATED
MAEA MISSION shRNA Lentiviral Transduction Particles
macrophage erythroblast attacher
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021500.2-1104s21c1
Sequence:CCGGCTGCTTTCTATTCGTCAAGATCTCGAGATCTTGACGAATAGAAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021500.2-1169s21c1
Sequence:CCGGCCAAGCTGAGAAAGTATACATCTCGAGATGTATACTTTCTCAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021500.2-293s21c1
Sequence:CCGGCAAGCTCTGCAAACGTAGGATCTCGAGATCCTACGTTTGCAGAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021500.2-1520s21c1
Sequence:CCGGGAATTGGTTCATCGGTTATTTCTCGAGAAATAACCGATGAACCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021500.2-801s21c1
Sequence:CCGGCTGATCCAGCAGTTTCGATATCTCGAGATATCGAAACTGCTGGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021500.1-255s1c1
Sequence:CCGGCAAGCTCTGCAAACGTAGGATCTCGAGATCCTACGTTTGCAGAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021500.1-621s1c1
Sequence:CCGGGAGACATGCAAGAAAGCACTTCTCGAGAAGTGCTTTCTTGCATGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021500.1-1131s1c1
Sequence:CCGGCCAAGCTGAGAAAGTATACATCTCGAGATGTATACTTTCTCAGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021500.1-1066s1c1
Sequence:CCGGCTGCTTTCTATTCGTCAAGATCTCGAGATCTTGACGAATAGAAAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005882
VALIDATED
MAEA MISSION shRNA Bacterial Glycerol Stock
macrophage erythroblast attacher
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005882.2-1012s1c1
Sequence:CCGGCCCGAGAACCAAAGAAGTCTTCTCGAGAAGACTTCTTTGGTTCTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005882.2-1025s1c1
Sequence:CCGGGAAGTCTTCCACTTCTCACAACTCGAGTTGTGAGAAGTGGAAGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005882.2-911s1c1
Sequence:CCGGGACGTGATGAACGAGAACAATCTCGAGATTGTTCTCGTTCATCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005882.2-1164s1c1
Sequence:CCGGCTGTTTCTTGCGACCAAAGATCTCGAGATCTTTGGTCGCAAGAAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005882.2-1017s1c1
Sequence:CCGGGAACCAAAGAAGTCTTCCACTCTCGAGAGTGGAAGACTTCTTTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005882.2-988s1c1
Sequence:CCGGCCGTCAAGATGATAAAGTCGTCTCGAGACGACTTTATCATCTTGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005882.2-527s1c1
Sequence:CCGGGCAAGAAAGCACTTCAGCCAACTCGAGTTGGCTGAAGTGCTTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005882.2-68s1c1
Sequence:CCGGGAGACGCTGAACAAACGCTTTCTCGAGAAAGCGTTTGTTCAGCGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005882.2-910s1c1
Sequence:CCGGCGACGTGATGAACGAGAACAACTCGAGTTGTTCTCGTTCATCACGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005882
VALIDATED
MAEA MISSION shRNA shRNA Plasmid DNA
macrophage erythroblast attacher
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005882.2-1012s1c1
Sequence:CCGGCCCGAGAACCAAAGAAGTCTTCTCGAGAAGACTTCTTTGGTTCTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005882.2-1025s1c1
Sequence:CCGGGAAGTCTTCCACTTCTCACAACTCGAGTTGTGAGAAGTGGAAGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005882.2-911s1c1
Sequence:CCGGGACGTGATGAACGAGAACAATCTCGAGATTGTTCTCGTTCATCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005882.2-1164s1c1
Sequence:CCGGCTGTTTCTTGCGACCAAAGATCTCGAGATCTTTGGTCGCAAGAAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005882.2-1017s1c1
Sequence:CCGGGAACCAAAGAAGTCTTCCACTCTCGAGAGTGGAAGACTTCTTTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005882.2-988s1c1
Sequence:CCGGCCGTCAAGATGATAAAGTCGTCTCGAGACGACTTTATCATCTTGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005882.2-527s1c1
Sequence:CCGGGCAAGAAAGCACTTCAGCCAACTCGAGTTGGCTGAAGTGCTTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005882.2-68s1c1
Sequence:CCGGGAGACGCTGAACAAACGCTTTCTCGAGAAAGCGTTTGTTCAGCGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005882.2-910s1c1
Sequence:CCGGCGACGTGATGAACGAGAACAACTCGAGTTGTTCTCGTTCATCACGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005882
VALIDATED
MAEA MISSION shRNA Lentiviral Transduction Particles
macrophage erythroblast attacher
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005882.2-1012s1c1
Sequence:CCGGCCCGAGAACCAAAGAAGTCTTCTCGAGAAGACTTCTTTGGTTCTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005882.2-1025s1c1
Sequence:CCGGGAAGTCTTCCACTTCTCACAACTCGAGTTGTGAGAAGTGGAAGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005882.2-911s1c1
Sequence:CCGGGACGTGATGAACGAGAACAATCTCGAGATTGTTCTCGTTCATCACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005882.2-1164s1c1
Sequence:CCGGCTGTTTCTTGCGACCAAAGATCTCGAGATCTTTGGTCGCAAGAAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005882.2-1017s1c1
Sequence:CCGGGAACCAAAGAAGTCTTCCACTCTCGAGAGTGGAAGACTTCTTTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005882.2-988s1c1
Sequence:CCGGCCGTCAAGATGATAAAGTCGTCTCGAGACGACTTTATCATCTTGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005882.2-527s1c1
Sequence:CCGGGCAAGAAAGCACTTCAGCCAACTCGAGTTGGCTGAAGTGCTTTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005882.2-68s1c1
Sequence:CCGGGAGACGCTGAACAAACGCTTTCTCGAGAAAGCGTTTGTTCAGCGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005882.2-910s1c1
Sequence:CCGGCGACGTGATGAACGAGAACAACTCGAGTTGTTCTCGTTCATCACGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)